Incidental Mutation 'R8154:Ccr9'
ID633211
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R8154 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123779831 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 193 (S193P)
Ref Sequence ENSEMBL: ENSMUSP00000131782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably benign
Transcript: ENSMUST00000111454
AA Change: S181P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: S181P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163559
AA Change: S193P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: S193P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166236
AA Change: S193P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: S193P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168910
AA Change: S193P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: S193P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180093
AA Change: S193P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: S193P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G T 3: 122,924,493 G12C probably damaging Het
Adamts10 C A 17: 33,537,928 P357T probably damaging Het
Bmyc T A 2: 25,707,334 S137T probably damaging Het
Bpifa1 T A 2: 154,145,734 M168K possibly damaging Het
C530008M17Rik A T 5: 76,841,797 E62D unknown Het
Card11 T G 5: 140,900,977 K339T probably damaging Het
Ccdc149 C T 5: 52,385,104 probably null Het
Csf2rb A G 15: 78,340,442 probably null Het
Cux1 T C 5: 136,252,580 E576G probably damaging Het
Cyp4a30b A G 4: 115,458,296 N238S probably benign Het
D430042O09Rik T C 7: 125,813,630 L382P probably damaging Het
Dnaja3 C A 16: 4,699,876 T375K possibly damaging Het
Espnl C T 1: 91,325,199 H217Y possibly damaging Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Fcgbp A G 7: 28,085,082 D189G probably benign Het
Gle1 T A 2: 29,938,607 probably null Het
Gm5346 A T 8: 43,625,387 I600N probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gtf2i A T 5: 134,251,867 F583L probably benign Het
Heatr9 T A 11: 83,511,877 Y532F possibly damaging Het
Hic2 C T 16: 17,258,480 S391L probably benign Het
Hipk1 A G 3: 103,749,336 V905A probably damaging Het
Inpp5f T G 7: 128,664,267 W211G possibly damaging Het
Kcnma1 T A 14: 23,311,754 Y1123F possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lmod3 T A 6: 97,247,980 K293N probably damaging Het
Luzp1 T C 4: 136,541,884 S473P possibly damaging Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map4k4 T G 1: 40,021,142 Y1030* probably null Het
Miga1 A G 3: 152,320,700 probably benign Het
Mrpl18 T C 17: 12,911,721 E167G probably damaging Het
Myh4 A G 11: 67,253,374 E1190G probably damaging Het
Ngef C T 1: 87,540,760 M92I probably benign Het
Nlrc4 T A 17: 74,445,909 Y493F probably damaging Het
Olfr601 A C 7: 103,358,556 C213G probably benign Het
Otud7a C A 7: 63,757,864 F638L probably benign Het
Padi2 T A 4: 140,924,309 probably null Het
Pcdhgb1 A G 18: 37,682,543 I696V probably damaging Het
Pikfyve T C 1: 65,265,789 F1745S probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prrc2b C T 2: 32,218,677 A1637V probably benign Het
Rab3il1 A T 19: 10,027,572 M57L possibly damaging Het
Rbl2 A G 8: 91,107,197 D885G probably damaging Het
Rbm25 A G 12: 83,644,431 M47V unknown Het
Rd3l T A 12: 111,980,204 H46L probably benign Het
Scn5a C G 9: 119,562,545 R27P possibly damaging Het
Set T A 2: 30,069,088 V99D probably benign Het
Sh3tc1 T A 5: 35,718,352 I138F probably damaging Het
Slf2 T A 19: 44,935,157 S137T possibly damaging Het
Smg8 A T 11: 87,085,237 M506K possibly damaging Het
Stpg2 G A 3: 139,309,177 V368M probably damaging Het
Trav16d-dv11 T C 14: 53,047,542 V25A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Vrk1 A G 12: 106,070,534 K360E probably benign Het
Xirp2 T A 2: 67,511,673 H1419Q possibly damaging Het
Yes1 T C 5: 32,645,022 F94L probably damaging Het
Zc2hc1c T C 12: 85,290,172 L201P probably benign Het
Zfp638 C T 6: 83,977,409 R1499W probably damaging Het
Znfx1 A T 2: 167,055,237 L589Q probably damaging Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
hamlet UTSW 9 123779439 missense probably damaging 1.00
Laertes UTSW 9 123779846 missense probably damaging 1.00
Ophelia UTSW 9 123779469 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123779970 missense probably benign 0.18
R0421:Ccr9 UTSW 9 123779606 missense probably benign
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4645:Ccr9 UTSW 9 123779593 missense probably benign 0.00
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123779439 missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123779469 missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123779957 missense probably benign 0.08
R8283:Ccr9 UTSW 9 123779631 missense probably damaging 1.00
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGTGCAAGGTTGTGAACAG -3'
(R):5'- GCTTGGATGACTTCTTGGCC -3'

Sequencing Primer
(F):5'- CAAGATGAACTTCTACAGCTGTGTGC -3'
(R):5'- TGGCCTGTACCAAGGTATGAATG -3'
Posted On2020-06-30