Incidental Mutation 'R8154:Vrk1'
ID633218
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R8154 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106070534 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 360 (K360E)
Ref Sequence ENSEMBL: ENSMUSP00000021539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
Predicted Effect probably benign
Transcript: ENSMUST00000021539
AA Change: K360E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115
AA Change: K360E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072040
AA Change: K360E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115
AA Change: K360E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085026
AA Change: K360E

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115
AA Change: K360E

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220629
AA Change: K360E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000221312
AA Change: K360E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G T 3: 122,924,493 G12C probably damaging Het
Adamts10 C A 17: 33,537,928 P357T probably damaging Het
Bmyc T A 2: 25,707,334 S137T probably damaging Het
Bpifa1 T A 2: 154,145,734 M168K possibly damaging Het
C530008M17Rik A T 5: 76,841,797 E62D unknown Het
Card11 T G 5: 140,900,977 K339T probably damaging Het
Ccdc149 C T 5: 52,385,104 probably null Het
Ccr9 T C 9: 123,779,831 S193P probably benign Het
Csf2rb A G 15: 78,340,442 probably null Het
Cux1 T C 5: 136,252,580 E576G probably damaging Het
Cyp4a30b A G 4: 115,458,296 N238S probably benign Het
D430042O09Rik T C 7: 125,813,630 L382P probably damaging Het
Dnaja3 C A 16: 4,699,876 T375K possibly damaging Het
Espnl C T 1: 91,325,199 H217Y possibly damaging Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Fcgbp A G 7: 28,085,082 D189G probably benign Het
Gle1 T A 2: 29,938,607 probably null Het
Gm5346 A T 8: 43,625,387 I600N probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gtf2i A T 5: 134,251,867 F583L probably benign Het
Heatr9 T A 11: 83,511,877 Y532F possibly damaging Het
Hic2 C T 16: 17,258,480 S391L probably benign Het
Hipk1 A G 3: 103,749,336 V905A probably damaging Het
Inpp5f T G 7: 128,664,267 W211G possibly damaging Het
Kcnma1 T A 14: 23,311,754 Y1123F possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lmod3 T A 6: 97,247,980 K293N probably damaging Het
Luzp1 T C 4: 136,541,884 S473P possibly damaging Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map4k4 T G 1: 40,021,142 Y1030* probably null Het
Miga1 A G 3: 152,320,700 probably benign Het
Mrpl18 T C 17: 12,911,721 E167G probably damaging Het
Myh4 A G 11: 67,253,374 E1190G probably damaging Het
Ngef C T 1: 87,540,760 M92I probably benign Het
Nlrc4 T A 17: 74,445,909 Y493F probably damaging Het
Olfr601 A C 7: 103,358,556 C213G probably benign Het
Otud7a C A 7: 63,757,864 F638L probably benign Het
Padi2 T A 4: 140,924,309 probably null Het
Pcdhgb1 A G 18: 37,682,543 I696V probably damaging Het
Pikfyve T C 1: 65,265,789 F1745S probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prrc2b C T 2: 32,218,677 A1637V probably benign Het
Rab3il1 A T 19: 10,027,572 M57L possibly damaging Het
Rbl2 A G 8: 91,107,197 D885G probably damaging Het
Rbm25 A G 12: 83,644,431 M47V unknown Het
Rd3l T A 12: 111,980,204 H46L probably benign Het
Scn5a C G 9: 119,562,545 R27P possibly damaging Het
Set T A 2: 30,069,088 V99D probably benign Het
Sh3tc1 T A 5: 35,718,352 I138F probably damaging Het
Slf2 T A 19: 44,935,157 S137T possibly damaging Het
Smg8 A T 11: 87,085,237 M506K possibly damaging Het
Stpg2 G A 3: 139,309,177 V368M probably damaging Het
Trav16d-dv11 T C 14: 53,047,542 V25A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Xirp2 T A 2: 67,511,673 H1419Q possibly damaging Het
Yes1 T C 5: 32,645,022 F94L probably damaging Het
Zc2hc1c T C 12: 85,290,172 L201P probably benign Het
Zfp638 C T 6: 83,977,409 R1499W probably damaging Het
Znfx1 A T 2: 167,055,237 L589Q probably damaging Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0332:Vrk1 UTSW 12 106058625 missense probably benign 0.05
R0790:Vrk1 UTSW 12 106070624 missense probably benign
R1897:Vrk1 UTSW 12 106036540 splice site probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106051793 missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106057972 missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106051828 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCACGTCCTGTTGGTCAGTG -3'
(R):5'- TTATATGACTCACGTGGCCAG -3'

Sequencing Primer
(F):5'- TGGCAGGAGAAAGACCCCAC -3'
(R):5'- CAGTCCATCAGCTAGTGGGAG -3'
Posted On2020-06-30