Incidental Mutation 'R8154:Csf2rb'
ID 633223
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
MMRRC Submission
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8154 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 78340442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000096355] [ENSMUST00000229034] [ENSMUST00000229678] [ENSMUST00000229678] [ENSMUST00000230264] [ENSMUST00000230264] [ENSMUST00000231888]
AlphaFold P26955
Predicted Effect probably null
Transcript: ENSMUST00000096355
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000096355
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229034
Predicted Effect probably null
Transcript: ENSMUST00000229678
Predicted Effect probably null
Transcript: ENSMUST00000229678
Predicted Effect probably null
Transcript: ENSMUST00000230264
Predicted Effect probably null
Transcript: ENSMUST00000230264
Predicted Effect probably benign
Transcript: ENSMUST00000231888
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G T 3: 122,924,493 G12C probably damaging Het
Adamts10 C A 17: 33,537,928 P357T probably damaging Het
Bmyc T A 2: 25,707,334 S137T probably damaging Het
Bpifa1 T A 2: 154,145,734 M168K possibly damaging Het
C530008M17Rik A T 5: 76,841,797 E62D unknown Het
Card11 T G 5: 140,900,977 K339T probably damaging Het
Ccdc149 C T 5: 52,385,104 probably null Het
Ccr9 T C 9: 123,779,831 S193P probably benign Het
Cux1 T C 5: 136,252,580 E576G probably damaging Het
Cyp4a30b A G 4: 115,458,296 N238S probably benign Het
D430042O09Rik T C 7: 125,813,630 L382P probably damaging Het
Dnaja3 C A 16: 4,699,876 T375K possibly damaging Het
Espnl C T 1: 91,325,199 H217Y possibly damaging Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Fcgbp A G 7: 28,085,082 D189G probably benign Het
Gle1 T A 2: 29,938,607 probably null Het
Gm5346 A T 8: 43,625,387 I600N probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gtf2i A T 5: 134,251,867 F583L probably benign Het
Heatr9 T A 11: 83,511,877 Y532F possibly damaging Het
Hic2 C T 16: 17,258,480 S391L probably benign Het
Hipk1 A G 3: 103,749,336 V905A probably damaging Het
Inpp5f T G 7: 128,664,267 W211G possibly damaging Het
Kcnma1 T A 14: 23,311,754 Y1123F possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lmod3 T A 6: 97,247,980 K293N probably damaging Het
Luzp1 T C 4: 136,541,884 S473P possibly damaging Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map4k4 T G 1: 40,021,142 Y1030* probably null Het
Miga1 A G 3: 152,320,700 probably benign Het
Mrpl18 T C 17: 12,911,721 E167G probably damaging Het
Myh4 A G 11: 67,253,374 E1190G probably damaging Het
Ngef C T 1: 87,540,760 M92I probably benign Het
Nlrc4 T A 17: 74,445,909 Y493F probably damaging Het
Olfr601 A C 7: 103,358,556 C213G probably benign Het
Otud7a C A 7: 63,757,864 F638L probably benign Het
Padi2 T A 4: 140,924,309 probably null Het
Pcdhgb1 A G 18: 37,682,543 I696V probably damaging Het
Pikfyve T C 1: 65,265,789 F1745S probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prrc2b C T 2: 32,218,677 A1637V probably benign Het
Rab3il1 A T 19: 10,027,572 M57L possibly damaging Het
Rbl2 A G 8: 91,107,197 D885G probably damaging Het
Rbm25 A G 12: 83,644,431 M47V unknown Het
Rd3l T A 12: 111,980,204 H46L probably benign Het
Scn5a C G 9: 119,562,545 R27P possibly damaging Het
Set T A 2: 30,069,088 V99D probably benign Het
Sh3tc1 T A 5: 35,718,352 I138F probably damaging Het
Slf2 T A 19: 44,935,157 S137T possibly damaging Het
Smg8 A T 11: 87,085,237 M506K possibly damaging Het
Stpg2 G A 3: 139,309,177 V368M probably damaging Het
Trav16d-dv11 T C 14: 53,047,542 V25A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Vrk1 A G 12: 106,070,534 K360E probably benign Het
Xirp2 T A 2: 67,511,673 H1419Q possibly damaging Het
Yes1 T C 5: 32,645,022 F94L probably damaging Het
Zc2hc1c T C 12: 85,290,172 L201P probably benign Het
Zfp638 C T 6: 83,977,409 R1499W probably damaging Het
Znfx1 A T 2: 167,055,237 L589Q probably damaging Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTCAGAAAGCATCAGTG -3'
(R):5'- AGGAACCTGACATGCCATC -3'

Sequencing Primer
(F):5'- ATCAGTGCACAGCAGGGC -3'
(R):5'- TGGACACAGACGGCTCAG -3'
Posted On 2020-06-30