Incidental Mutation 'R8155:Tbx15'
ID 633244
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 067581-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R8155 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 99259886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 586 (Q586K)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: Q586K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Q586K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,330,497 (GRCm39) T1386I probably damaging Het
Abcb6 A T 1: 75,151,413 (GRCm39) V504E probably damaging Het
Abtb3 G A 10: 85,476,473 (GRCm39) probably null Het
Adprhl1 C T 8: 13,271,764 (GRCm39) A1665T probably damaging Het
Arhgap32 T A 9: 32,093,196 (GRCm39) L183H probably damaging Het
Arhgef12 A G 9: 42,953,958 (GRCm39) L24S probably damaging Het
B3gnt4 C T 5: 123,649,426 (GRCm39) H264Y possibly damaging Het
Cfi A G 3: 129,648,739 (GRCm39) T208A probably benign Het
Chd4 T A 6: 125,082,287 (GRCm39) F605Y probably benign Het
Cimap1d A T 10: 79,481,466 (GRCm39) V21E probably benign Het
Clip1 A G 5: 123,751,699 (GRCm39) L694P Het
Crybb3 A T 5: 113,225,466 (GRCm39) D135E probably damaging Het
Ddx60 T A 8: 62,470,205 (GRCm39) S1398T possibly damaging Het
Dusp5 T A 19: 53,529,537 (GRCm39) Y313* probably null Het
Eloa A G 4: 135,734,438 (GRCm39) V689A probably benign Het
Ep300 T A 15: 81,505,269 (GRCm39) Y630N unknown Het
Galnt5 A T 2: 57,889,427 (GRCm39) K342N probably benign Het
Gm4841 A G 18: 60,403,409 (GRCm39) V228A probably damaging Het
Gna14 A T 19: 16,576,338 (GRCm39) D115V probably benign Het
Gpx5 T C 13: 21,472,917 (GRCm39) D139G probably damaging Het
Hmcn1 G T 1: 150,480,705 (GRCm39) N4490K probably damaging Het
Hsp90aa1 T C 12: 110,661,828 (GRCm39) S63G unknown Het
Itpkb T C 1: 180,159,913 (GRCm39) I13T possibly damaging Het
Itprid2 T C 2: 79,475,177 (GRCm39) S379P probably benign Het
Lamb2 C T 9: 108,357,845 (GRCm39) R123W probably damaging Het
Ldha A G 7: 46,503,508 (GRCm39) H300R probably damaging Het
Lrp2 A G 2: 69,313,342 (GRCm39) L2463P possibly damaging Het
Morf4l1 A G 9: 89,977,225 (GRCm39) I232T probably damaging Het
Mtg1 A G 7: 139,724,622 (GRCm39) H166R probably benign Het
Or14a260 A G 7: 85,985,386 (GRCm39) S73P probably damaging Het
Or2ad1 A G 13: 21,327,062 (GRCm39) L55P probably damaging Het
Or52r1 C T 7: 102,536,452 (GRCm39) D303N probably benign Het
Or5d46 A G 2: 88,170,296 (GRCm39) N129S probably damaging Het
Or6d12 T A 6: 116,492,813 (GRCm39) V25E probably benign Het
Or7g32 A T 9: 19,389,453 (GRCm39) V31D probably benign Het
Papss2 A G 19: 32,618,742 (GRCm39) T267A probably benign Het
Park7 G A 4: 150,991,547 (GRCm39) R48C possibly damaging Het
Pecr A G 1: 72,309,443 (GRCm39) V199A probably damaging Het
Pla2g10 G A 16: 13,543,048 (GRCm39) R80W probably damaging Het
Plek2 G A 12: 78,943,066 (GRCm39) R77* probably null Het
Psg23 A G 7: 18,346,179 (GRCm39) L172P probably damaging Het
Psg25 A C 7: 18,260,445 (GRCm39) F151C probably benign Het
Ptpn3 G T 4: 57,232,336 (GRCm39) H433Q probably benign Het
Rasal3 A G 17: 32,616,381 (GRCm39) V294A possibly damaging Het
Rnf6 T C 5: 146,147,815 (GRCm39) D401G probably damaging Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Sema3d T C 5: 12,498,148 (GRCm39) probably null Het
Serpinb1c A T 13: 33,081,038 (GRCm39) L15Q probably damaging Het
Slfn3 T A 11: 83,103,611 (GRCm39) Y161N probably damaging Het
Spns2 T C 11: 72,347,394 (GRCm39) M404V possibly damaging Het
Stk39 T A 2: 68,097,410 (GRCm39) I479L probably damaging Het
Thap11 C T 8: 106,582,854 (GRCm39) R288* probably null Het
Tm7sf2 T A 19: 6,114,125 (GRCm39) D236V probably damaging Het
Tmem214 T C 5: 31,029,136 (GRCm39) S192P possibly damaging Het
Tnfaip3 A G 10: 18,880,439 (GRCm39) S543P possibly damaging Het
Traf3ip3 A G 1: 192,860,524 (GRCm39) L466P probably damaging Het
Tspan18 C T 2: 93,040,357 (GRCm39) probably null Het
Vmn1r229 T A 17: 21,035,472 (GRCm39) L239Q probably damaging Het
Vsig2 T C 9: 37,455,329 (GRCm39) V293A possibly damaging Het
Wdfy4 A T 14: 32,884,776 (GRCm39) V42D Het
Wnk2 G A 13: 49,192,577 (GRCm39) P2055S unknown Het
Zfp953 C A 13: 67,491,535 (GRCm39) C139F probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGCCCAGAGAAACTG -3'
(R):5'- AGGATCCTTCAGCGGTATCTATTG -3'

Sequencing Primer
(F):5'- AGAAACTGAGCGCGTCTC -3'
(R):5'- CAGCGGTATCTATTGTTGTTCTC -3'
Posted On 2020-06-30