Mutagenetix > Incidental Mutation

Incidental Mutation 'R8155:Tbx15'

633244

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R8155 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 99352570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 586 (Q586K)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: Q586K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Q586K

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	G	A	1: 71,291,338	T1386I	probably damaging	Het
Abcb6	A	T	1: 75,174,769	V504E	probably damaging	Het
Adprhl1	C	T	8: 13,221,764	A1665T	probably damaging	Het
Arhgap32	T	A	9: 32,181,900	L183H	probably damaging	Het
Arhgef12	A	G	9: 43,042,662	L24S	probably damaging	Het
B3gnt4	C	T	5: 123,511,363	H264Y	possibly damaging	Het
Btbd11	G	A	10: 85,640,609		probably null	Het
Cfi	A	G	3: 129,855,090	T208A	probably benign	Het
Chd4	T	A	6: 125,105,324	F605Y	probably benign	Het
Clip1	A	G	5: 123,613,636	L694P		Het
Crybb3	A	T	5: 113,077,600	D135E	probably damaging	Het
Ddx60	T	A	8: 62,017,171	S1398T	possibly damaging	Het
Dusp5	T	A	19: 53,541,106	Y313*	probably null	Het
Eloa	A	G	4: 136,007,127	V689A	probably benign	Het
Ep300	T	A	15: 81,621,068	Y630N	unknown	Het
Galnt5	A	T	2: 57,999,415	K342N	probably benign	Het
Gm4841	A	G	18: 60,270,337	V228A	probably damaging	Het
Gna14	A	T	19: 16,598,974	D115V	probably benign	Het
Gpx5	T	C	13: 21,288,747	D139G	probably damaging	Het
Hmcn1	G	T	1: 150,604,954	N4490K	probably damaging	Het
Hsp90aa1	T	C	12: 110,695,394	S63G	unknown	Het
Itpkb	T	C	1: 180,332,348	I13T	possibly damaging	Het
Lamb2	C	T	9: 108,480,646	R123W	probably damaging	Het
Ldha	A	G	7: 46,854,084	H300R	probably damaging	Het
Lrp2	A	G	2: 69,482,998	L2463P	possibly damaging	Het
Morf4l1	A	G	9: 90,095,172	I232T	probably damaging	Het
Mtg1	A	G	7: 140,144,709	H166R	probably benign	Het
Odf3l2	A	T	10: 79,645,632	V21E	probably benign	Het
Olfr1176	A	G	2: 88,339,952	N129S	probably damaging	Het
Olfr1368	A	G	13: 21,142,892	L55P	probably damaging	Het
Olfr212	T	A	6: 116,515,852	V25E	probably benign	Het
Olfr307	A	G	7: 86,336,178	S73P	probably damaging	Het
Olfr569	C	T	7: 102,887,245	D303N	probably benign	Het
Olfr850	A	T	9: 19,478,157	V31D	probably benign	Het
Papss2	A	G	19: 32,641,342	T267A	probably benign	Het
Park7	G	A	4: 150,907,090	R48C	possibly damaging	Het
Pecr	A	G	1: 72,270,284	V199A	probably damaging	Het
Pla2g10	G	A	16: 13,725,184	R80W	probably damaging	Het
Plek2	G	A	12: 78,896,292	R77*	probably null	Het
Psg23	A	G	7: 18,612,254	L172P	probably damaging	Het
Psg25	A	C	7: 18,526,520	F151C	probably benign	Het
Ptpn3	G	T	4: 57,232,336	H433Q	probably benign	Het
Rasal3	A	G	17: 32,397,407	V294A	possibly damaging	Het
Rnf6	T	C	5: 146,211,005	D401G	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Sema3d	T	C	5: 12,448,181		probably null	Het
Serpinb1c	A	T	13: 32,897,055	L15Q	probably damaging	Het
Slfn3	T	A	11: 83,212,785	Y161N	probably damaging	Het
Spns2	T	C	11: 72,456,568	M404V	possibly damaging	Het
Ssfa2	T	C	2: 79,644,833	S379P	probably benign	Het
Stk39	T	A	2: 68,267,066	I479L	probably damaging	Het
Thap11	C	T	8: 105,856,222	R288*	probably null	Het
Tm7sf2	T	A	19: 6,064,095	D236V	probably damaging	Het
Tmem214	T	C	5: 30,871,792	S192P	possibly damaging	Het
Tnfaip3	A	G	10: 19,004,691	S543P	possibly damaging	Het
Traf3ip3	A	G	1: 193,178,216	L466P	probably damaging	Het
Tspan18	C	T	2: 93,210,012		probably null	Het
Vmn1r229	T	A	17: 20,815,210	L239Q	probably damaging	Het
Vsig2	T	C	9: 37,544,033	V293A	possibly damaging	Het
Wdfy4	A	T	14: 33,162,819	V42D		Het
Wnk2	G	A	13: 49,039,101	P2055S	unknown	Het
Zfp953	C	A	13: 67,343,471	C139F	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAAGCCCAGAGAAACTG -3'
(R):5'- AGGATCCTTCAGCGGTATCTATTG -3'

Sequencing Primer
(F):5'- AGAAACTGAGCGCGTCTC -3'
(R):5'- CAGCGGTATCTATTGTTGTTCTC -3'

Posted On

2020-06-30