Incidental Mutation 'R8155:Cfi'
ID633245
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8155 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129855090 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 208 (T208A)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect probably benign
Transcript: ENSMUST00000077918
AA Change: T208A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: T208A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200206
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,291,338 T1386I probably damaging Het
Abcb6 A T 1: 75,174,769 V504E probably damaging Het
Adprhl1 C T 8: 13,221,764 A1665T probably damaging Het
Arhgap32 T A 9: 32,181,900 L183H probably damaging Het
Arhgef12 A G 9: 43,042,662 L24S probably damaging Het
B3gnt4 C T 5: 123,511,363 H264Y possibly damaging Het
Btbd11 G A 10: 85,640,609 probably null Het
Chd4 T A 6: 125,105,324 F605Y probably benign Het
Clip1 A G 5: 123,613,636 L694P Het
Crybb3 A T 5: 113,077,600 D135E probably damaging Het
Ddx60 T A 8: 62,017,171 S1398T possibly damaging Het
Dusp5 T A 19: 53,541,106 Y313* probably null Het
Eloa A G 4: 136,007,127 V689A probably benign Het
Ep300 T A 15: 81,621,068 Y630N unknown Het
Galnt5 A T 2: 57,999,415 K342N probably benign Het
Gm4841 A G 18: 60,270,337 V228A probably damaging Het
Gna14 A T 19: 16,598,974 D115V probably benign Het
Gpx5 T C 13: 21,288,747 D139G probably damaging Het
Hmcn1 G T 1: 150,604,954 N4490K probably damaging Het
Hsp90aa1 T C 12: 110,695,394 S63G unknown Het
Itpkb T C 1: 180,332,348 I13T possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldha A G 7: 46,854,084 H300R probably damaging Het
Lrp2 A G 2: 69,482,998 L2463P possibly damaging Het
Morf4l1 A G 9: 90,095,172 I232T probably damaging Het
Mtg1 A G 7: 140,144,709 H166R probably benign Het
Odf3l2 A T 10: 79,645,632 V21E probably benign Het
Olfr1176 A G 2: 88,339,952 N129S probably damaging Het
Olfr1368 A G 13: 21,142,892 L55P probably damaging Het
Olfr212 T A 6: 116,515,852 V25E probably benign Het
Olfr307 A G 7: 86,336,178 S73P probably damaging Het
Olfr569 C T 7: 102,887,245 D303N probably benign Het
Olfr850 A T 9: 19,478,157 V31D probably benign Het
Papss2 A G 19: 32,641,342 T267A probably benign Het
Park7 G A 4: 150,907,090 R48C possibly damaging Het
Pecr A G 1: 72,270,284 V199A probably damaging Het
Pla2g10 G A 16: 13,725,184 R80W probably damaging Het
Plek2 G A 12: 78,896,292 R77* probably null Het
Psg23 A G 7: 18,612,254 L172P probably damaging Het
Psg25 A C 7: 18,526,520 F151C probably benign Het
Ptpn3 G T 4: 57,232,336 H433Q probably benign Het
Rasal3 A G 17: 32,397,407 V294A possibly damaging Het
Rnf6 T C 5: 146,211,005 D401G probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sema3d T C 5: 12,448,181 probably null Het
Serpinb1c A T 13: 32,897,055 L15Q probably damaging Het
Slfn3 T A 11: 83,212,785 Y161N probably damaging Het
Spns2 T C 11: 72,456,568 M404V possibly damaging Het
Ssfa2 T C 2: 79,644,833 S379P probably benign Het
Stk39 T A 2: 68,267,066 I479L probably damaging Het
Tbx15 C A 3: 99,352,570 Q586K possibly damaging Het
Thap11 C T 8: 105,856,222 R288* probably null Het
Tm7sf2 T A 19: 6,064,095 D236V probably damaging Het
Tmem214 T C 5: 30,871,792 S192P possibly damaging Het
Tnfaip3 A G 10: 19,004,691 S543P possibly damaging Het
Traf3ip3 A G 1: 193,178,216 L466P probably damaging Het
Tspan18 C T 2: 93,210,012 probably null Het
Vmn1r229 T A 17: 20,815,210 L239Q probably damaging Het
Vsig2 T C 9: 37,544,033 V293A possibly damaging Het
Wdfy4 A T 14: 33,162,819 V42D Het
Wnk2 G A 13: 49,039,101 P2055S unknown Het
Zfp953 C A 13: 67,343,471 C139F probably damaging Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7194:Cfi UTSW 3 129855059 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7908:Cfi UTSW 3 129848584 missense probably benign 0.01
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8017:Cfi UTSW 3 129855099 missense probably benign 0.00
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8217:Cfi UTSW 3 129855001 missense possibly damaging 0.61
R8530:Cfi UTSW 3 129850733 missense possibly damaging 0.79
R8767:Cfi UTSW 3 129850848 critical splice donor site probably null
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACACAGAGTTTATTCTTCCACCAG -3'
(R):5'- TGGACGGCAGGTTTCAAGTG -3'

Sequencing Primer
(F):5'- AGTTTTCACTCATTCTGTTTGCAGG -3'
(R):5'- GGAGGGTCCCAAATACCAGTTC -3'
Posted On2020-06-30