Incidental Mutation 'R8155:Park7'
ID633248
Institutional Source Beutler Lab
Gene Symbol Park7
Ensembl Gene ENSMUSG00000028964
Gene NameParkinson disease (autosomal recessive, early onset) 7
SynonymsDJ-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R8155 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150897133-150914437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150907090 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 48 (R48C)
Ref Sequence ENSEMBL: ENSMUSP00000030805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030805
AA Change: R48C

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105673
AA Change: R48C

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105674
AA Change: R48C

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 4 171 1.2e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105675
AA Change: R48C

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105676
AA Change: R48C

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.7e-16 PFAM
Pfam:DJ-1_PfpI 32 171 3.6e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128075
AA Change: R48C

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DUF4066 9 135 1.1e-15 PFAM
Pfam:DJ-1_PfpI 32 136 1.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134751
AA Change: R48C

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 114 6.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146184
AA Change: R48C

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964
AA Change: R48C

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 84 4e-10 PFAM
Meta Mutation Damage Score 0.7136 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,291,338 T1386I probably damaging Het
Abcb6 A T 1: 75,174,769 V504E probably damaging Het
Adprhl1 C T 8: 13,221,764 A1665T probably damaging Het
Arhgap32 T A 9: 32,181,900 L183H probably damaging Het
Arhgef12 A G 9: 43,042,662 L24S probably damaging Het
B3gnt4 C T 5: 123,511,363 H264Y possibly damaging Het
Btbd11 G A 10: 85,640,609 probably null Het
Cfi A G 3: 129,855,090 T208A probably benign Het
Chd4 T A 6: 125,105,324 F605Y probably benign Het
Clip1 A G 5: 123,613,636 L694P Het
Crybb3 A T 5: 113,077,600 D135E probably damaging Het
Ddx60 T A 8: 62,017,171 S1398T possibly damaging Het
Dusp5 T A 19: 53,541,106 Y313* probably null Het
Eloa A G 4: 136,007,127 V689A probably benign Het
Ep300 T A 15: 81,621,068 Y630N unknown Het
Galnt5 A T 2: 57,999,415 K342N probably benign Het
Gm4841 A G 18: 60,270,337 V228A probably damaging Het
Gna14 A T 19: 16,598,974 D115V probably benign Het
Gpx5 T C 13: 21,288,747 D139G probably damaging Het
Hmcn1 G T 1: 150,604,954 N4490K probably damaging Het
Hsp90aa1 T C 12: 110,695,394 S63G unknown Het
Itpkb T C 1: 180,332,348 I13T possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldha A G 7: 46,854,084 H300R probably damaging Het
Lrp2 A G 2: 69,482,998 L2463P possibly damaging Het
Morf4l1 A G 9: 90,095,172 I232T probably damaging Het
Mtg1 A G 7: 140,144,709 H166R probably benign Het
Odf3l2 A T 10: 79,645,632 V21E probably benign Het
Olfr1176 A G 2: 88,339,952 N129S probably damaging Het
Olfr1368 A G 13: 21,142,892 L55P probably damaging Het
Olfr212 T A 6: 116,515,852 V25E probably benign Het
Olfr307 A G 7: 86,336,178 S73P probably damaging Het
Olfr569 C T 7: 102,887,245 D303N probably benign Het
Olfr850 A T 9: 19,478,157 V31D probably benign Het
Papss2 A G 19: 32,641,342 T267A probably benign Het
Pecr A G 1: 72,270,284 V199A probably damaging Het
Pla2g10 G A 16: 13,725,184 R80W probably damaging Het
Plek2 G A 12: 78,896,292 R77* probably null Het
Psg23 A G 7: 18,612,254 L172P probably damaging Het
Psg25 A C 7: 18,526,520 F151C probably benign Het
Ptpn3 G T 4: 57,232,336 H433Q probably benign Het
Rasal3 A G 17: 32,397,407 V294A possibly damaging Het
Rnf6 T C 5: 146,211,005 D401G probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sema3d T C 5: 12,448,181 probably null Het
Serpinb1c A T 13: 32,897,055 L15Q probably damaging Het
Slfn3 T A 11: 83,212,785 Y161N probably damaging Het
Spns2 T C 11: 72,456,568 M404V possibly damaging Het
Ssfa2 T C 2: 79,644,833 S379P probably benign Het
Stk39 T A 2: 68,267,066 I479L probably damaging Het
Tbx15 C A 3: 99,352,570 Q586K possibly damaging Het
Thap11 C T 8: 105,856,222 R288* probably null Het
Tm7sf2 T A 19: 6,064,095 D236V probably damaging Het
Tmem214 T C 5: 30,871,792 S192P possibly damaging Het
Tnfaip3 A G 10: 19,004,691 S543P possibly damaging Het
Traf3ip3 A G 1: 193,178,216 L466P probably damaging Het
Tspan18 C T 2: 93,210,012 probably null Het
Vmn1r229 T A 17: 20,815,210 L239Q probably damaging Het
Vsig2 T C 9: 37,544,033 V293A possibly damaging Het
Wdfy4 A T 14: 33,162,819 V42D Het
Wnk2 G A 13: 49,039,101 P2055S unknown Het
Zfp953 C A 13: 67,343,471 C139F probably damaging Het
Other mutations in Park7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Park7 APN 4 150903831 missense probably benign 0.28
stiffed UTSW 4 150907090 missense possibly damaging 0.82
R0268:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R0344:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R2062:Park7 UTSW 4 150905275 missense probably benign 0.05
R2416:Park7 UTSW 4 150908401 missense probably benign 0.01
R3032:Park7 UTSW 4 150901052 missense probably benign 0.00
R4638:Park7 UTSW 4 150907099 nonsense probably null
R5345:Park7 UTSW 4 150908423 splice site probably benign
R6585:Park7 UTSW 4 150905264 missense probably benign 0.01
R7957:Park7 UTSW 4 150903884 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGACACAGGATCCAGACC -3'
(R):5'- TCAGCTACAAATTAGGGCTGTC -3'

Sequencing Primer
(F):5'- GGATCCAGACCCTCCACC -3'
(R):5'- CCAGAAGAGACCAGGTGTTATTTACC -3'
Posted On2020-06-30