Incidental Mutation 'R8155:Or52r1'
ID 633262
Institutional Source Beutler Lab
Gene Symbol Or52r1
Ensembl Gene ENSMUSG00000062142
Gene Name olfactory receptor family 52 subfamily R member 1
Synonyms MOR30-1, GA_x6K02T2PBJ9-5599295-5598351, Olfr569
MMRRC Submission 067581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8155 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102536414-102537358 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102536452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 303 (D303N)
Ref Sequence ENSEMBL: ENSMUSP00000149088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078191] [ENSMUST00000217024]
AlphaFold Q8VGZ2
Predicted Effect probably benign
Transcript: ENSMUST00000078191
AA Change: D303N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077321
Gene: ENSMUSG00000062142
AA Change: D303N

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.2e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 229 1.3e-9 PFAM
Pfam:7tm_1 43 294 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217024
AA Change: D303N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,330,497 (GRCm39) T1386I probably damaging Het
Abcb6 A T 1: 75,151,413 (GRCm39) V504E probably damaging Het
Abtb3 G A 10: 85,476,473 (GRCm39) probably null Het
Adprhl1 C T 8: 13,271,764 (GRCm39) A1665T probably damaging Het
Arhgap32 T A 9: 32,093,196 (GRCm39) L183H probably damaging Het
Arhgef12 A G 9: 42,953,958 (GRCm39) L24S probably damaging Het
B3gnt4 C T 5: 123,649,426 (GRCm39) H264Y possibly damaging Het
Cfi A G 3: 129,648,739 (GRCm39) T208A probably benign Het
Chd4 T A 6: 125,082,287 (GRCm39) F605Y probably benign Het
Cimap1d A T 10: 79,481,466 (GRCm39) V21E probably benign Het
Clip1 A G 5: 123,751,699 (GRCm39) L694P Het
Crybb3 A T 5: 113,225,466 (GRCm39) D135E probably damaging Het
Ddx60 T A 8: 62,470,205 (GRCm39) S1398T possibly damaging Het
Dusp5 T A 19: 53,529,537 (GRCm39) Y313* probably null Het
Eloa A G 4: 135,734,438 (GRCm39) V689A probably benign Het
Ep300 T A 15: 81,505,269 (GRCm39) Y630N unknown Het
Galnt5 A T 2: 57,889,427 (GRCm39) K342N probably benign Het
Gm4841 A G 18: 60,403,409 (GRCm39) V228A probably damaging Het
Gna14 A T 19: 16,576,338 (GRCm39) D115V probably benign Het
Gpx5 T C 13: 21,472,917 (GRCm39) D139G probably damaging Het
Hmcn1 G T 1: 150,480,705 (GRCm39) N4490K probably damaging Het
Hsp90aa1 T C 12: 110,661,828 (GRCm39) S63G unknown Het
Itpkb T C 1: 180,159,913 (GRCm39) I13T possibly damaging Het
Itprid2 T C 2: 79,475,177 (GRCm39) S379P probably benign Het
Lamb2 C T 9: 108,357,845 (GRCm39) R123W probably damaging Het
Ldha A G 7: 46,503,508 (GRCm39) H300R probably damaging Het
Lrp2 A G 2: 69,313,342 (GRCm39) L2463P possibly damaging Het
Morf4l1 A G 9: 89,977,225 (GRCm39) I232T probably damaging Het
Mtg1 A G 7: 139,724,622 (GRCm39) H166R probably benign Het
Or14a260 A G 7: 85,985,386 (GRCm39) S73P probably damaging Het
Or2ad1 A G 13: 21,327,062 (GRCm39) L55P probably damaging Het
Or5d46 A G 2: 88,170,296 (GRCm39) N129S probably damaging Het
Or6d12 T A 6: 116,492,813 (GRCm39) V25E probably benign Het
Or7g32 A T 9: 19,389,453 (GRCm39) V31D probably benign Het
Papss2 A G 19: 32,618,742 (GRCm39) T267A probably benign Het
Park7 G A 4: 150,991,547 (GRCm39) R48C possibly damaging Het
Pecr A G 1: 72,309,443 (GRCm39) V199A probably damaging Het
Pla2g10 G A 16: 13,543,048 (GRCm39) R80W probably damaging Het
Plek2 G A 12: 78,943,066 (GRCm39) R77* probably null Het
Psg23 A G 7: 18,346,179 (GRCm39) L172P probably damaging Het
Psg25 A C 7: 18,260,445 (GRCm39) F151C probably benign Het
Ptpn3 G T 4: 57,232,336 (GRCm39) H433Q probably benign Het
Rasal3 A G 17: 32,616,381 (GRCm39) V294A possibly damaging Het
Rnf6 T C 5: 146,147,815 (GRCm39) D401G probably damaging Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Sema3d T C 5: 12,498,148 (GRCm39) probably null Het
Serpinb1c A T 13: 33,081,038 (GRCm39) L15Q probably damaging Het
Slfn3 T A 11: 83,103,611 (GRCm39) Y161N probably damaging Het
Spns2 T C 11: 72,347,394 (GRCm39) M404V possibly damaging Het
Stk39 T A 2: 68,097,410 (GRCm39) I479L probably damaging Het
Tbx15 C A 3: 99,259,886 (GRCm39) Q586K possibly damaging Het
Thap11 C T 8: 106,582,854 (GRCm39) R288* probably null Het
Tm7sf2 T A 19: 6,114,125 (GRCm39) D236V probably damaging Het
Tmem214 T C 5: 31,029,136 (GRCm39) S192P possibly damaging Het
Tnfaip3 A G 10: 18,880,439 (GRCm39) S543P possibly damaging Het
Traf3ip3 A G 1: 192,860,524 (GRCm39) L466P probably damaging Het
Tspan18 C T 2: 93,040,357 (GRCm39) probably null Het
Vmn1r229 T A 17: 21,035,472 (GRCm39) L239Q probably damaging Het
Vsig2 T C 9: 37,455,329 (GRCm39) V293A possibly damaging Het
Wdfy4 A T 14: 32,884,776 (GRCm39) V42D Het
Wnk2 G A 13: 49,192,577 (GRCm39) P2055S unknown Het
Zfp953 C A 13: 67,491,535 (GRCm39) C139F probably damaging Het
Other mutations in Or52r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Or52r1 APN 7 102,536,814 (GRCm39) missense probably damaging 1.00
IGL02505:Or52r1 APN 7 102,536,814 (GRCm39) missense probably damaging 1.00
IGL02885:Or52r1 APN 7 102,537,243 (GRCm39) missense possibly damaging 0.83
IGL03339:Or52r1 APN 7 102,536,989 (GRCm39) missense probably benign 0.02
R0383:Or52r1 UTSW 7 102,536,458 (GRCm39) missense possibly damaging 0.91
R1767:Or52r1 UTSW 7 102,536,833 (GRCm39) missense probably damaging 1.00
R1793:Or52r1 UTSW 7 102,537,250 (GRCm39) missense probably benign 0.44
R1812:Or52r1 UTSW 7 102,537,285 (GRCm39) missense probably benign 0.32
R6061:Or52r1 UTSW 7 102,537,158 (GRCm39) missense probably benign 0.31
R7855:Or52r1 UTSW 7 102,536,835 (GRCm39) missense probably benign 0.01
R8890:Or52r1 UTSW 7 102,536,699 (GRCm39) nonsense probably null
R9131:Or52r1 UTSW 7 102,537,186 (GRCm39) missense probably benign 0.07
R9188:Or52r1 UTSW 7 102,536,596 (GRCm39) missense possibly damaging 0.95
R9398:Or52r1 UTSW 7 102,537,000 (GRCm39) missense probably damaging 1.00
Z1177:Or52r1 UTSW 7 102,536,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATAAAGAGATTCCAAGATGGGG -3'
(R):5'- CAAAGCTTTTGGTACATGTGCTTC -3'

Sequencing Primer
(F):5'- TCCACAAAAGGTTTCAAATCTCTC -3'
(R):5'- AGCTTTTGGTACATGTGCTTCTCATG -3'
Posted On 2020-06-30