Incidental Mutation 'R8155:Ddx60'
ID633265
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R8155 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62017171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1398 (S1398T)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: S1397T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: S1397T

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: S1398T

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: S1398T

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,291,338 T1386I probably damaging Het
Abcb6 A T 1: 75,174,769 V504E probably damaging Het
Adprhl1 C T 8: 13,221,764 A1665T probably damaging Het
Arhgap32 T A 9: 32,181,900 L183H probably damaging Het
Arhgef12 A G 9: 43,042,662 L24S probably damaging Het
B3gnt4 C T 5: 123,511,363 H264Y possibly damaging Het
Btbd11 G A 10: 85,640,609 probably null Het
Cfi A G 3: 129,855,090 T208A probably benign Het
Chd4 T A 6: 125,105,324 F605Y probably benign Het
Clip1 A G 5: 123,613,636 L694P Het
Crybb3 A T 5: 113,077,600 D135E probably damaging Het
Dusp5 T A 19: 53,541,106 Y313* probably null Het
Eloa A G 4: 136,007,127 V689A probably benign Het
Ep300 T A 15: 81,621,068 Y630N unknown Het
Galnt5 A T 2: 57,999,415 K342N probably benign Het
Gm4841 A G 18: 60,270,337 V228A probably damaging Het
Gna14 A T 19: 16,598,974 D115V probably benign Het
Gpx5 T C 13: 21,288,747 D139G probably damaging Het
Hmcn1 G T 1: 150,604,954 N4490K probably damaging Het
Hsp90aa1 T C 12: 110,695,394 S63G unknown Het
Itpkb T C 1: 180,332,348 I13T possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldha A G 7: 46,854,084 H300R probably damaging Het
Lrp2 A G 2: 69,482,998 L2463P possibly damaging Het
Morf4l1 A G 9: 90,095,172 I232T probably damaging Het
Mtg1 A G 7: 140,144,709 H166R probably benign Het
Odf3l2 A T 10: 79,645,632 V21E probably benign Het
Olfr1176 A G 2: 88,339,952 N129S probably damaging Het
Olfr1368 A G 13: 21,142,892 L55P probably damaging Het
Olfr212 T A 6: 116,515,852 V25E probably benign Het
Olfr307 A G 7: 86,336,178 S73P probably damaging Het
Olfr569 C T 7: 102,887,245 D303N probably benign Het
Olfr850 A T 9: 19,478,157 V31D probably benign Het
Papss2 A G 19: 32,641,342 T267A probably benign Het
Park7 G A 4: 150,907,090 R48C possibly damaging Het
Pecr A G 1: 72,270,284 V199A probably damaging Het
Pla2g10 G A 16: 13,725,184 R80W probably damaging Het
Plek2 G A 12: 78,896,292 R77* probably null Het
Psg23 A G 7: 18,612,254 L172P probably damaging Het
Psg25 A C 7: 18,526,520 F151C probably benign Het
Ptpn3 G T 4: 57,232,336 H433Q probably benign Het
Rasal3 A G 17: 32,397,407 V294A possibly damaging Het
Rnf6 T C 5: 146,211,005 D401G probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sema3d T C 5: 12,448,181 probably null Het
Serpinb1c A T 13: 32,897,055 L15Q probably damaging Het
Slfn3 T A 11: 83,212,785 Y161N probably damaging Het
Spns2 T C 11: 72,456,568 M404V possibly damaging Het
Ssfa2 T C 2: 79,644,833 S379P probably benign Het
Stk39 T A 2: 68,267,066 I479L probably damaging Het
Tbx15 C A 3: 99,352,570 Q586K possibly damaging Het
Thap11 C T 8: 105,856,222 R288* probably null Het
Tm7sf2 T A 19: 6,064,095 D236V probably damaging Het
Tmem214 T C 5: 30,871,792 S192P possibly damaging Het
Tnfaip3 A G 10: 19,004,691 S543P possibly damaging Het
Traf3ip3 A G 1: 193,178,216 L466P probably damaging Het
Tspan18 C T 2: 93,210,012 probably null Het
Vmn1r229 T A 17: 20,815,210 L239Q probably damaging Het
Vsig2 T C 9: 37,544,033 V293A possibly damaging Het
Wdfy4 A T 14: 33,162,819 V42D Het
Wnk2 G A 13: 49,039,101 P2055S unknown Het
Zfp953 C A 13: 67,343,471 C139F probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAAAAGGAAGCACTCACAATGTTTC -3'
(R):5'- CTGAAGATTACAACAATGCAATGTGG -3'

Sequencing Primer
(F):5'- GTGACATGTAACTAAGCCTG -3'
(R):5'- GAGACCCTGAACTCAGTTTTCCAG -3'
Posted On2020-06-30