Incidental Mutation 'R8155:Arhgap32'
ID633268
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8155 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32181900 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 183 (L183H)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect probably damaging
Transcript: ENSMUST00000174641
AA Change: L183H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: L183H

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182310
AA Change: L158H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.3659 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,291,338 T1386I probably damaging Het
Abcb6 A T 1: 75,174,769 V504E probably damaging Het
Adprhl1 C T 8: 13,221,764 A1665T probably damaging Het
Arhgef12 A G 9: 43,042,662 L24S probably damaging Het
B3gnt4 C T 5: 123,511,363 H264Y possibly damaging Het
Btbd11 G A 10: 85,640,609 probably null Het
Cfi A G 3: 129,855,090 T208A probably benign Het
Chd4 T A 6: 125,105,324 F605Y probably benign Het
Clip1 A G 5: 123,613,636 L694P Het
Crybb3 A T 5: 113,077,600 D135E probably damaging Het
Ddx60 T A 8: 62,017,171 S1398T possibly damaging Het
Dusp5 T A 19: 53,541,106 Y313* probably null Het
Eloa A G 4: 136,007,127 V689A probably benign Het
Ep300 T A 15: 81,621,068 Y630N unknown Het
Galnt5 A T 2: 57,999,415 K342N probably benign Het
Gm4841 A G 18: 60,270,337 V228A probably damaging Het
Gna14 A T 19: 16,598,974 D115V probably benign Het
Gpx5 T C 13: 21,288,747 D139G probably damaging Het
Hmcn1 G T 1: 150,604,954 N4490K probably damaging Het
Hsp90aa1 T C 12: 110,695,394 S63G unknown Het
Itpkb T C 1: 180,332,348 I13T possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldha A G 7: 46,854,084 H300R probably damaging Het
Lrp2 A G 2: 69,482,998 L2463P possibly damaging Het
Morf4l1 A G 9: 90,095,172 I232T probably damaging Het
Mtg1 A G 7: 140,144,709 H166R probably benign Het
Odf3l2 A T 10: 79,645,632 V21E probably benign Het
Olfr1176 A G 2: 88,339,952 N129S probably damaging Het
Olfr1368 A G 13: 21,142,892 L55P probably damaging Het
Olfr212 T A 6: 116,515,852 V25E probably benign Het
Olfr307 A G 7: 86,336,178 S73P probably damaging Het
Olfr569 C T 7: 102,887,245 D303N probably benign Het
Olfr850 A T 9: 19,478,157 V31D probably benign Het
Papss2 A G 19: 32,641,342 T267A probably benign Het
Park7 G A 4: 150,907,090 R48C possibly damaging Het
Pecr A G 1: 72,270,284 V199A probably damaging Het
Pla2g10 G A 16: 13,725,184 R80W probably damaging Het
Plek2 G A 12: 78,896,292 R77* probably null Het
Psg23 A G 7: 18,612,254 L172P probably damaging Het
Psg25 A C 7: 18,526,520 F151C probably benign Het
Ptpn3 G T 4: 57,232,336 H433Q probably benign Het
Rasal3 A G 17: 32,397,407 V294A possibly damaging Het
Rnf6 T C 5: 146,211,005 D401G probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sema3d T C 5: 12,448,181 probably null Het
Serpinb1c A T 13: 32,897,055 L15Q probably damaging Het
Slfn3 T A 11: 83,212,785 Y161N probably damaging Het
Spns2 T C 11: 72,456,568 M404V possibly damaging Het
Ssfa2 T C 2: 79,644,833 S379P probably benign Het
Stk39 T A 2: 68,267,066 I479L probably damaging Het
Tbx15 C A 3: 99,352,570 Q586K possibly damaging Het
Thap11 C T 8: 105,856,222 R288* probably null Het
Tm7sf2 T A 19: 6,064,095 D236V probably damaging Het
Tmem214 T C 5: 30,871,792 S192P possibly damaging Het
Tnfaip3 A G 10: 19,004,691 S543P possibly damaging Het
Traf3ip3 A G 1: 193,178,216 L466P probably damaging Het
Tspan18 C T 2: 93,210,012 probably null Het
Vmn1r229 T A 17: 20,815,210 L239Q probably damaging Het
Vsig2 T C 9: 37,544,033 V293A possibly damaging Het
Wdfy4 A T 14: 33,162,819 V42D Het
Wnk2 G A 13: 49,039,101 P2055S unknown Het
Zfp953 C A 13: 67,343,471 C139F probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32257028 missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGGAGTGTTTGGAGCTGAAC -3'
(R):5'- TGTTTACTTCTGCACCCTAGAAAG -3'

Sequencing Primer
(F):5'- GTTTGGAGCTGAACTGATTATCATC -3'
(R):5'- TCTCTCCTGAAATAAGCAATCTCAGG -3'
Posted On2020-06-30