Mutagenetix > Incidental Mutation

Incidental Mutation 'R8156:Kcnb2'

633295

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15710056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 384 (Y384F)

Ref Sequence

ENSEMBL: ENSMUSP00000126656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably damaging
Transcript: ENSMUST00000170146
AA Change: Y384F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000175681
AA Change: Y384F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Y384F

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Meta Mutation Damage Score

0.5382

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alyref	T	C	11: 120,598,248	R31G	probably benign	Het
Arfgef2	GTGTGCAGAAACT	GT	2: 166,834,463	92	probably null	Het
Arhgap31	G	T	16: 38,625,629	A118E	probably damaging	Het
Asb5	T	A	8: 54,550,506	I21K	probably damaging	Het
Asxl2	A	G	12: 3,496,760	I515V	probably benign	Het
Bend7	C	T	2: 4,752,854	P236S	probably benign	Het
C330027C09Rik	A	G	16: 48,997,462	D65G	probably damaging	Het
C4bp	T	C	1: 130,639,087	T351A	probably benign	Het
Cd1d2	T	A	3: 86,987,262		probably null	Het
Chd1	T	A	17: 15,761,404	D1368E	probably benign	Het
Chrnb3	A	G	8: 27,393,654	I140V	probably benign	Het
Col6a2	T	C	10: 76,596,791	T843A	possibly damaging	Het
Dnajc2	A	G	5: 21,781,319		probably null	Het
Dopey1	A	G	9: 86,494,457	D248G	probably damaging	Het
Dtna	T	A	18: 23,590,331	C197*	probably null	Het
Flg2	T	C	3: 93,220,083	S2101P	unknown	Het
Foxg1	A	G	12: 49,384,646	H54R	unknown	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr35	A	G	1: 92,982,715	T50A	probably damaging	Het
Gsta3	A	T	1: 21,260,098	Y108F	probably benign	Het
Hdac4	G	T	1: 91,958,416	A811E	probably damaging	Het
Hephl1	A	T	9: 15,060,914	V910E	possibly damaging	Het
Kmt2a	T	C	9: 44,822,389	I2210M	unknown	Het
Lamb2	C	T	9: 108,480,646	R123W	probably damaging	Het
Lrriq1	A	G	10: 103,156,335		probably null	Het
Lsm4	G	A	8: 70,678,368	G112S	probably damaging	Het
Myt1	T	C	2: 181,822,761		probably null	Het
Ndor1	T	C	2: 25,248,734	R396G	probably benign	Het
Olfr1118	A	C	2: 87,308,974	I82L	probably damaging	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Prdm2	A	G	4: 143,134,768	S651P	probably benign	Het
Prkaa2	T	C	4: 105,051,975	M91V	probably benign	Het
Pskh1	G	A	8: 105,913,594	R302H	probably benign	Het
Rab11fip4	A	G	11: 79,686,589	T390A	probably benign	Het
Snx10	T	C	6: 51,562,019		probably benign	Het
Taar5	T	C	10: 23,971,495	C264R	probably damaging	Het
Tcf20	A	G	15: 82,852,937	C1438R	probably benign	Het
Tfap2d	A	G	1: 19,103,262	T3A	probably benign	Het
Toporsl	A	G	4: 52,609,975		probably benign	Het
Trim71	A	G	9: 114,513,124	S697P	probably benign	Het
Ufl1	T	C	4: 25,269,057	D258G	probably damaging	Het
Vmn1r28	T	C	6: 58,265,198	Y9H	probably damaging	Het
Zfp995	T	A	17: 21,880,134	H373L	probably damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GGATACTGAAACTCGCCAGAC -3'
(R):5'- AACGATGCTGCCATTTCTTTTGG -3'

Sequencing Primer
(F):5'- TCTGGGCTTCACACTCAGG -3'
(R):5'- ATAGCTTTCTCCTGGCGT -3'

Posted On

2020-06-30