Incidental Mutation 'R8156:Flg2'
ID633307
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8156 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93220083 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2101 (S2101P)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: S2101P
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: S2101P

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref T C 11: 120,598,248 R31G probably benign Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 probably null Het
Arhgap31 G T 16: 38,625,629 A118E probably damaging Het
Asb5 T A 8: 54,550,506 I21K probably damaging Het
Asxl2 A G 12: 3,496,760 I515V probably benign Het
Bend7 C T 2: 4,752,854 P236S probably benign Het
C330027C09Rik A G 16: 48,997,462 D65G probably damaging Het
C4bp T C 1: 130,639,087 T351A probably benign Het
Cd1d2 T A 3: 86,987,262 probably null Het
Chd1 T A 17: 15,761,404 D1368E probably benign Het
Chrnb3 A G 8: 27,393,654 I140V probably benign Het
Col6a2 T C 10: 76,596,791 T843A possibly damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Dopey1 A G 9: 86,494,457 D248G probably damaging Het
Dtna T A 18: 23,590,331 C197* probably null Het
Foxg1 A G 12: 49,384,646 H54R unknown Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr35 A G 1: 92,982,715 T50A probably damaging Het
Gsta3 A T 1: 21,260,098 Y108F probably benign Het
Hdac4 G T 1: 91,958,416 A811E probably damaging Het
Hephl1 A T 9: 15,060,914 V910E possibly damaging Het
Kcnb2 A T 1: 15,710,056 Y384F probably damaging Het
Kmt2a T C 9: 44,822,389 I2210M unknown Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lrriq1 A G 10: 103,156,335 probably null Het
Lsm4 G A 8: 70,678,368 G112S probably damaging Het
Myt1 T C 2: 181,822,761 probably null Het
Ndor1 T C 2: 25,248,734 R396G probably benign Het
Olfr1118 A C 2: 87,308,974 I82L probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prdm2 A G 4: 143,134,768 S651P probably benign Het
Prkaa2 T C 4: 105,051,975 M91V probably benign Het
Pskh1 G A 8: 105,913,594 R302H probably benign Het
Rab11fip4 A G 11: 79,686,589 T390A probably benign Het
Snx10 T C 6: 51,562,019 probably benign Het
Taar5 T C 10: 23,971,495 C264R probably damaging Het
Tcf20 A G 15: 82,852,937 C1438R probably benign Het
Tfap2d A G 1: 19,103,262 T3A probably benign Het
Toporsl A G 4: 52,609,975 probably benign Het
Trim71 A G 9: 114,513,124 S697P probably benign Het
Ufl1 T C 4: 25,269,057 D258G probably damaging Het
Vmn1r28 T C 6: 58,265,198 Y9H probably damaging Het
Zfp995 T A 17: 21,880,134 H373L probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTAGACTTTCTGGCCATTATGG -3'
(R):5'- CTACAGAATGGCCATGACTACACTC -3'

Sequencing Primer
(F):5'- CTTTCTGGCCATTATGGAAGAAATC -3'
(R):5'- TGGCCATGACTACACTCATGCC -3'
Posted On2020-06-30