Mutagenetix > Incidental Mutation

Incidental Mutation 'R8156:Prdm2'

633311

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

067582-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143134768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 651 (S651P)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: S651P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S651P

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alyref	T	C	11: 120,598,248	R31G	probably benign	Het
Arfgef2	GTGTGCAGAAACT	GT	2: 166,834,463	92	probably null	Het
Arhgap31	G	T	16: 38,625,629	A118E	probably damaging	Het
Asb5	T	A	8: 54,550,506	I21K	probably damaging	Het
Asxl2	A	G	12: 3,496,760	I515V	probably benign	Het
Bend7	C	T	2: 4,752,854	P236S	probably benign	Het
C330027C09Rik	A	G	16: 48,997,462	D65G	probably damaging	Het
C4bp	T	C	1: 130,639,087	T351A	probably benign	Het
Cd1d2	T	A	3: 86,987,262		probably null	Het
Chd1	T	A	17: 15,761,404	D1368E	probably benign	Het
Chrnb3	A	G	8: 27,393,654	I140V	probably benign	Het
Col6a2	T	C	10: 76,596,791	T843A	possibly damaging	Het
Dnajc2	A	G	5: 21,781,319		probably null	Het
Dopey1	A	G	9: 86,494,457	D248G	probably damaging	Het
Dtna	T	A	18: 23,590,331	C197*	probably null	Het
Flg2	T	C	3: 93,220,083	S2101P	unknown	Het
Foxg1	A	G	12: 49,384,646	H54R	unknown	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr35	A	G	1: 92,982,715	T50A	probably damaging	Het
Gsta3	A	T	1: 21,260,098	Y108F	probably benign	Het
Hdac4	G	T	1: 91,958,416	A811E	probably damaging	Het
Hephl1	A	T	9: 15,060,914	V910E	possibly damaging	Het
Kcnb2	A	T	1: 15,710,056	Y384F	probably damaging	Het
Kmt2a	T	C	9: 44,822,389	I2210M	unknown	Het
Lamb2	C	T	9: 108,480,646	R123W	probably damaging	Het
Lrriq1	A	G	10: 103,156,335		probably null	Het
Lsm4	G	A	8: 70,678,368	G112S	probably damaging	Het
Myt1	T	C	2: 181,822,761		probably null	Het
Ndor1	T	C	2: 25,248,734	R396G	probably benign	Het
Olfr1118	A	C	2: 87,308,974	I82L	probably damaging	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Prkaa2	T	C	4: 105,051,975	M91V	probably benign	Het
Pskh1	G	A	8: 105,913,594	R302H	probably benign	Het
Rab11fip4	A	G	11: 79,686,589	T390A	probably benign	Het
Snx10	T	C	6: 51,562,019		probably benign	Het
Taar5	T	C	10: 23,971,495	C264R	probably damaging	Het
Tcf20	A	G	15: 82,852,937	C1438R	probably benign	Het
Tfap2d	A	G	1: 19,103,262	T3A	probably benign	Het
Toporsl	A	G	4: 52,609,975		probably benign	Het
Trim71	A	G	9: 114,513,124	S697P	probably benign	Het
Ufl1	T	C	4: 25,269,057	D258G	probably damaging	Het
Vmn1r28	T	C	6: 58,265,198	Y9H	probably damaging	Het
Zfp995	T	A	17: 21,880,134	H373L	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
R9518:Prdm2	UTSW	4	143134009	missense	possibly damaging	0.94
R9546:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9547:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9680:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R9730:Prdm2	UTSW	4	143132089	missense	possibly damaging	0.73
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCACAGCTAACATGGATGCAG -3'
(R):5'- GCATAGACTGTCTGCTCACTCC -3'

Sequencing Primer
(F):5'- GATACACACACGGGACCTAACTTAG -3'
(R):5'- TGCTCACTCCAGTAACTGTAGAG -3'

Posted On

2020-06-30