Mutagenetix > Incidental Mutations

Incidental Mutation 'R8156:Prdm2'

633311

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143134768 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 651 (S651P)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: S651P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S651P

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alyref	T	C	11: 120,598,248	R31G	probably benign	Het
Arfgef2	GTGTGCAGAAACT	GT	2: 166,834,463		probably null	Het
Arhgap31	G	T	16: 38,625,629	A118E	probably damaging	Het
Asb5	T	A	8: 54,550,506	I21K	probably damaging	Het
Asxl2	A	G	12: 3,496,760	I515V	probably benign	Het
Bend7	C	T	2: 4,752,854	P236S	probably benign	Het
C330027C09Rik	A	G	16: 48,997,462	D65G	probably damaging	Het
C4bp	T	C	1: 130,639,087	T351A	probably benign	Het
Cd1d2	T	A	3: 86,987,262		probably null	Het
Chd1	T	A	17: 15,761,404	D1368E	probably benign	Het
Chrnb3	A	G	8: 27,393,654	I140V	probably benign	Het
Col6a2	T	C	10: 76,596,791	T843A	possibly damaging	Het
Dnajc2	A	G	5: 21,781,319		probably null	Het
Dopey1	A	G	9: 86,494,457	D248G	probably damaging	Het
Dtna	T	A	18: 23,590,331	C197*	probably null	Het
Flg2	T	C	3: 93,220,083	S2101P	unknown	Het
Foxg1	A	G	12: 49,384,646	H54R	unknown	Het
Gpr137b	T	C	13: 13,359,406	Y355C	probably damaging	Het
Gpr35	A	G	1: 92,982,715	T50A	probably damaging	Het
Gsta3	A	T	1: 21,260,098	Y108F	probably benign	Het
Hdac4	G	T	1: 91,958,416	A811E	probably damaging	Het
Hephl1	A	T	9: 15,060,914	V910E	possibly damaging	Het
Kcnb2	A	T	1: 15,710,056	Y384F	probably damaging	Het
Kmt2a	T	C	9: 44,822,389	I2210M	unknown	Het
Lamb2	C	T	9: 108,480,646	R123W	probably damaging	Het
Lrriq1	A	G	10: 103,156,335		probably null	Het
Lsm4	G	A	8: 70,678,368	G112S	probably damaging	Het
Myt1	T	C	2: 181,822,761		probably null	Het
Ndor1	T	C	2: 25,248,734	R396G	probably benign	Het
Olfr1118	A	C	2: 87,308,974	I82L	probably damaging	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Prkaa2	T	C	4: 105,051,975	M91V	probably benign	Het
Pskh1	G	A	8: 105,913,594	R302H	probably benign	Het
Rab11fip4	A	G	11: 79,686,589	T390A	probably benign	Het
Snx10	T	C	6: 51,562,019		probably benign	Het
Taar5	T	C	10: 23,971,495	C264R	probably damaging	Het
Tcf20	A	G	15: 82,852,937	C1438R	probably benign	Het
Tfap2d	A	G	1: 19,103,262	T3A	probably benign	Het
Toporsl	A	G	4: 52,609,975		probably benign	Het
Trim71	A	G	9: 114,513,124	S697P	probably benign	Het
Ufl1	T	C	4: 25,269,057	D258G	probably damaging	Het
Vmn1r28	T	C	6: 58,265,198	Y9H	probably damaging	Het
Zfp995	T	A	17: 21,880,134	H373L	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCACAGCTAACATGGATGCAG -3'
(R):5'- GCATAGACTGTCTGCTCACTCC -3'

Sequencing Primer
(F):5'- GATACACACACGGGACCTAACTTAG -3'
(R):5'- TGCTCACTCCAGTAACTGTAGAG -3'

Posted On

2020-06-30