Incidental Mutation 'R8156:Rab11fip4'
ID633327
Institutional Source Beutler Lab
Gene Symbol Rab11fip4
Ensembl Gene ENSMUSG00000017639
Gene NameRAB11 family interacting protein 4 (class II)
SynonymsA730072L08Rik, RAB11-FIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8156 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79591212-79698023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79686589 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 390 (T390A)
Ref Sequence ENSEMBL: ENSMUSP00000017783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017783] [ENSMUST00000155381]
Predicted Effect probably benign
Transcript: ENSMUST00000017783
AA Change: T390A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017783
Gene: ENSMUSG00000017639
AA Change: T390A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
SCOP:d1mr8a_ 17 90 2e-4 SMART
Blast:EFh 54 81 2e-10 BLAST
low complexity region 247 252 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Blast:BRLZ 507 574 7e-24 BLAST
Pfam:RBD-FIP 594 634 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155381
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with RAB11 and is thought to be involved in bringing recycling endosome membranes to the cleavage furrow in late cytokinesis. Hypoxic conditions can lead to an upregulation of the encoded protein and enhance the metastatic potential of hepatocellular carcinoma. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref T C 11: 120,598,248 R31G probably benign Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 probably null Het
Arhgap31 G T 16: 38,625,629 A118E probably damaging Het
Asb5 T A 8: 54,550,506 I21K probably damaging Het
Asxl2 A G 12: 3,496,760 I515V probably benign Het
Bend7 C T 2: 4,752,854 P236S probably benign Het
C330027C09Rik A G 16: 48,997,462 D65G probably damaging Het
C4bp T C 1: 130,639,087 T351A probably benign Het
Cd1d2 T A 3: 86,987,262 probably null Het
Chd1 T A 17: 15,761,404 D1368E probably benign Het
Chrnb3 A G 8: 27,393,654 I140V probably benign Het
Col6a2 T C 10: 76,596,791 T843A possibly damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Dopey1 A G 9: 86,494,457 D248G probably damaging Het
Dtna T A 18: 23,590,331 C197* probably null Het
Flg2 T C 3: 93,220,083 S2101P unknown Het
Foxg1 A G 12: 49,384,646 H54R unknown Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr35 A G 1: 92,982,715 T50A probably damaging Het
Gsta3 A T 1: 21,260,098 Y108F probably benign Het
Hdac4 G T 1: 91,958,416 A811E probably damaging Het
Hephl1 A T 9: 15,060,914 V910E possibly damaging Het
Kcnb2 A T 1: 15,710,056 Y384F probably damaging Het
Kmt2a T C 9: 44,822,389 I2210M unknown Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lrriq1 A G 10: 103,156,335 probably null Het
Lsm4 G A 8: 70,678,368 G112S probably damaging Het
Myt1 T C 2: 181,822,761 probably null Het
Ndor1 T C 2: 25,248,734 R396G probably benign Het
Olfr1118 A C 2: 87,308,974 I82L probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prdm2 A G 4: 143,134,768 S651P probably benign Het
Prkaa2 T C 4: 105,051,975 M91V probably benign Het
Pskh1 G A 8: 105,913,594 R302H probably benign Het
Snx10 T C 6: 51,562,019 probably benign Het
Taar5 T C 10: 23,971,495 C264R probably damaging Het
Tcf20 A G 15: 82,852,937 C1438R probably benign Het
Tfap2d A G 1: 19,103,262 T3A probably benign Het
Toporsl A G 4: 52,609,975 probably benign Het
Trim71 A G 9: 114,513,124 S697P probably benign Het
Ufl1 T C 4: 25,269,057 D258G probably damaging Het
Vmn1r28 T C 6: 58,265,198 Y9H probably damaging Het
Zfp995 T A 17: 21,880,134 H373L probably damaging Het
Other mutations in Rab11fip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Rab11fip4 APN 11 79691879 missense possibly damaging 0.70
IGL01867:Rab11fip4 APN 11 79683390 missense probably benign 0.04
R0013:Rab11fip4 UTSW 11 79689653 missense probably benign 0.27
R0277:Rab11fip4 UTSW 11 79686629 missense possibly damaging 0.82
R0737:Rab11fip4 UTSW 11 79683502 missense probably benign
R4975:Rab11fip4 UTSW 11 79619671 missense probably damaging 1.00
R5382:Rab11fip4 UTSW 11 79690715 missense possibly damaging 0.94
R5982:Rab11fip4 UTSW 11 79690775 missense probably benign
R6086:Rab11fip4 UTSW 11 79683480 missense probably damaging 1.00
R6267:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R6296:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R7468:Rab11fip4 UTSW 11 79689652 missense probably benign 0.02
R8307:Rab11fip4 UTSW 11 79690774 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TGTCACAGTGTCCCTAATTCAC -3'
(R):5'- CAGCTTTACCGGAAACCCTC -3'

Sequencing Primer
(F):5'- TAATTCACCTGTCAGCTAAGCTCAG -3'
(R):5'- CTCGGGGGCAGCACTAC -3'
Posted On2020-06-30