Incidental Mutation 'R8156:Tcf20'
ID633333
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Nametranscription factor 20
Synonymsstromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R8156 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82808436-82987872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82852937 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1438 (C1438R)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably benign
Transcript: ENSMUST00000048966
AA Change: C1438R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: C1438R

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109510
AA Change: C1438R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: C1438R

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref T C 11: 120,598,248 R31G probably benign Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 92 probably null Het
Arhgap31 G T 16: 38,625,629 A118E probably damaging Het
Asb5 T A 8: 54,550,506 I21K probably damaging Het
Asxl2 A G 12: 3,496,760 I515V probably benign Het
Bend7 C T 2: 4,752,854 P236S probably benign Het
C330027C09Rik A G 16: 48,997,462 D65G probably damaging Het
C4bp T C 1: 130,639,087 T351A probably benign Het
Cd1d2 T A 3: 86,987,262 probably null Het
Chd1 T A 17: 15,761,404 D1368E probably benign Het
Chrnb3 A G 8: 27,393,654 I140V probably benign Het
Col6a2 T C 10: 76,596,791 T843A possibly damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Dopey1 A G 9: 86,494,457 D248G probably damaging Het
Dtna T A 18: 23,590,331 C197* probably null Het
Flg2 T C 3: 93,220,083 S2101P unknown Het
Foxg1 A G 12: 49,384,646 H54R unknown Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr35 A G 1: 92,982,715 T50A probably damaging Het
Gsta3 A T 1: 21,260,098 Y108F probably benign Het
Hdac4 G T 1: 91,958,416 A811E probably damaging Het
Hephl1 A T 9: 15,060,914 V910E possibly damaging Het
Kcnb2 A T 1: 15,710,056 Y384F probably damaging Het
Kmt2a T C 9: 44,822,389 I2210M unknown Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lrriq1 A G 10: 103,156,335 probably null Het
Lsm4 G A 8: 70,678,368 G112S probably damaging Het
Myt1 T C 2: 181,822,761 probably null Het
Ndor1 T C 2: 25,248,734 R396G probably benign Het
Olfr1118 A C 2: 87,308,974 I82L probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prdm2 A G 4: 143,134,768 S651P probably benign Het
Prkaa2 T C 4: 105,051,975 M91V probably benign Het
Pskh1 G A 8: 105,913,594 R302H probably benign Het
Rab11fip4 A G 11: 79,686,589 T390A probably benign Het
Snx10 T C 6: 51,562,019 probably benign Het
Taar5 T C 10: 23,971,495 C264R probably damaging Het
Tfap2d A G 1: 19,103,262 T3A probably benign Het
Toporsl A G 4: 52,609,975 probably benign Het
Trim71 A G 9: 114,513,124 S697P probably benign Het
Ufl1 T C 4: 25,269,057 D258G probably damaging Het
Vmn1r28 T C 6: 58,265,198 Y9H probably damaging Het
Zfp995 T A 17: 21,880,134 H373L probably damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGTCATAGTACCAGAGGG -3'
(R):5'- CCCTGACAAGTCCTGCTAAGAC -3'

Sequencing Primer
(F):5'- CCAGAGGGTTCCTTTCCAGTAGAAG -3'
(R):5'- GTCCTGCTAAGACCAAAATACTG -3'
Posted On2020-06-30