Incidental Mutation 'R8156:Tcf20'
ID 633333
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
MMRRC Submission 067582-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.692) question?
Stock # R8156 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 82692637-82872073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82737138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1438 (C1438R)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably benign
Transcript: ENSMUST00000048966
AA Change: C1438R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: C1438R

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109510
AA Change: C1438R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: C1438R

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref T C 11: 120,489,074 (GRCm39) R31G probably benign Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,676,383 (GRCm39) 92 probably null Het
Arhgap31 G T 16: 38,445,991 (GRCm39) A118E probably damaging Het
Asb5 T A 8: 55,003,541 (GRCm39) I21K probably damaging Het
Asxl2 A G 12: 3,546,760 (GRCm39) I515V probably benign Het
Bend7 C T 2: 4,757,665 (GRCm39) P236S probably benign Het
C4bp T C 1: 130,566,824 (GRCm39) T351A probably benign Het
Cd1d2 T A 3: 86,894,569 (GRCm39) probably null Het
Chd1 T A 17: 15,981,666 (GRCm39) D1368E probably benign Het
Chrnb3 A G 8: 27,883,682 (GRCm39) I140V probably benign Het
Cip2a A G 16: 48,817,825 (GRCm39) D65G probably damaging Het
Col6a2 T C 10: 76,432,625 (GRCm39) T843A possibly damaging Het
Dnajc2 A G 5: 21,986,317 (GRCm39) probably null Het
Dop1a A G 9: 86,376,510 (GRCm39) D248G probably damaging Het
Dtna T A 18: 23,723,388 (GRCm39) C197* probably null Het
Flg2 T C 3: 93,127,390 (GRCm39) S2101P unknown Het
Foxg1 A G 12: 49,431,429 (GRCm39) H54R unknown Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr35 A G 1: 92,910,437 (GRCm39) T50A probably damaging Het
Gsta3 A T 1: 21,330,322 (GRCm39) Y108F probably benign Het
Hdac4 G T 1: 91,886,138 (GRCm39) A811E probably damaging Het
Hephl1 A T 9: 14,972,210 (GRCm39) V910E possibly damaging Het
Kcnb2 A T 1: 15,780,280 (GRCm39) Y384F probably damaging Het
Kmt2a T C 9: 44,733,686 (GRCm39) I2210M unknown Het
Lamb2 C T 9: 108,357,845 (GRCm39) R123W probably damaging Het
Lrriq1 A G 10: 102,992,196 (GRCm39) probably null Het
Lsm4 G A 8: 71,131,018 (GRCm39) G112S probably damaging Het
Myt1 T C 2: 181,464,554 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,746 (GRCm39) R396G probably benign Het
Or10ag56 A C 2: 87,139,318 (GRCm39) I82L probably damaging Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Prdm2 A G 4: 142,861,338 (GRCm39) S651P probably benign Het
Prkaa2 T C 4: 104,909,172 (GRCm39) M91V probably benign Het
Pskh1 G A 8: 106,640,226 (GRCm39) R302H probably benign Het
Rab11fip4 A G 11: 79,577,415 (GRCm39) T390A probably benign Het
Snx10 T C 6: 51,538,999 (GRCm39) probably benign Het
Taar5 T C 10: 23,847,393 (GRCm39) C264R probably damaging Het
Tfap2d A G 1: 19,173,486 (GRCm39) T3A probably benign Het
Toporsl A G 4: 52,609,975 (GRCm39) probably benign Het
Trim71 A G 9: 114,342,192 (GRCm39) S697P probably benign Het
Ufl1 T C 4: 25,269,057 (GRCm39) D258G probably damaging Het
Vmn1r28 T C 6: 58,242,183 (GRCm39) Y9H probably damaging Het
Zfp995 T A 17: 22,099,115 (GRCm39) H373L probably damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82,739,096 (GRCm39) missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82,741,343 (GRCm39) missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82,736,957 (GRCm39) missense probably benign 0.41
IGL00576:Tcf20 APN 15 82,740,276 (GRCm39) missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82,738,101 (GRCm39) missense probably benign
IGL01670:Tcf20 APN 15 82,739,564 (GRCm39) missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82,741,361 (GRCm39) missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82,740,209 (GRCm39) missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82,737,167 (GRCm39) missense probably benign
IGL01834:Tcf20 APN 15 82,739,898 (GRCm39) missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82,739,356 (GRCm39) missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82,737,660 (GRCm39) missense probably benign 0.28
IGL02731:Tcf20 APN 15 82,737,438 (GRCm39) missense probably benign 0.00
IGL02739:Tcf20 APN 15 82,740,281 (GRCm39) missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82,736,205 (GRCm39) missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82,735,785 (GRCm39) missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82,736,501 (GRCm39) missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82,739,286 (GRCm39) missense probably benign
R0732:Tcf20 UTSW 15 82,736,504 (GRCm39) missense probably benign 0.07
R1502:Tcf20 UTSW 15 82,739,777 (GRCm39) missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82,739,693 (GRCm39) missense probably benign 0.19
R1719:Tcf20 UTSW 15 82,736,978 (GRCm39) missense probably benign 0.03
R1997:Tcf20 UTSW 15 82,741,431 (GRCm39) nonsense probably null
R2152:Tcf20 UTSW 15 82,739,803 (GRCm39) missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82,738,893 (GRCm39) missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82,735,886 (GRCm39) missense probably benign
R4049:Tcf20 UTSW 15 82,737,630 (GRCm39) missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82,739,185 (GRCm39) missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82,735,928 (GRCm39) missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82,738,400 (GRCm39) missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82,740,804 (GRCm39) missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82,740,386 (GRCm39) missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82,740,582 (GRCm39) missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82,740,156 (GRCm39) missense probably benign 0.01
R5288:Tcf20 UTSW 15 82,739,910 (GRCm39) missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82,736,158 (GRCm39) missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82,740,400 (GRCm39) missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82,737,443 (GRCm39) missense probably benign 0.05
R5897:Tcf20 UTSW 15 82,735,984 (GRCm39) nonsense probably null
R6089:Tcf20 UTSW 15 82,737,409 (GRCm39) missense probably benign 0.06
R6196:Tcf20 UTSW 15 82,736,187 (GRCm39) missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82,739,081 (GRCm39) missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82,736,861 (GRCm39) missense probably benign
R6688:Tcf20 UTSW 15 82,738,736 (GRCm39) missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82,738,883 (GRCm39) missense probably benign 0.07
R7051:Tcf20 UTSW 15 82,740,279 (GRCm39) missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82,737,690 (GRCm39) missense probably benign
R7486:Tcf20 UTSW 15 82,737,935 (GRCm39) missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82,739,477 (GRCm39) missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82,735,766 (GRCm39) missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82,740,207 (GRCm39) missense probably damaging 1.00
R8191:Tcf20 UTSW 15 82,737,606 (GRCm39) nonsense probably null
R8259:Tcf20 UTSW 15 82,736,474 (GRCm39) missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82,736,877 (GRCm39) missense probably benign 0.04
R8447:Tcf20 UTSW 15 82,737,437 (GRCm39) missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82,740,152 (GRCm39) missense probably benign 0.07
R8728:Tcf20 UTSW 15 82,739,158 (GRCm39) missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82,739,915 (GRCm39) missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82,736,726 (GRCm39) missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9268:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9294:Tcf20 UTSW 15 82,736,897 (GRCm39) missense probably benign 0.11
R9648:Tcf20 UTSW 15 82,739,876 (GRCm39) missense probably damaging 1.00
R9675:Tcf20 UTSW 15 82,740,986 (GRCm39) missense probably damaging 1.00
R9729:Tcf20 UTSW 15 82,736,037 (GRCm39) missense probably benign 0.25
RF019:Tcf20 UTSW 15 82,735,794 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGTCATAGTACCAGAGGG -3'
(R):5'- CCCTGACAAGTCCTGCTAAGAC -3'

Sequencing Primer
(F):5'- CCAGAGGGTTCCTTTCCAGTAGAAG -3'
(R):5'- GTCCTGCTAAGACCAAAATACTG -3'
Posted On 2020-06-30