Incidental Mutation 'R8156:Dtna'
ID633338
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Namedystrobrevin alpha
Synonymsalpha-dystrobrevin, adbn, Dtn, a-DB-1, A0, 87K protein, 2210407P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R8156 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location23415135-23659715 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 23590331 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 197 (C197*)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047954] [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
Predicted Effect probably null
Transcript: ENSMUST00000047954
AA Change: C197*
SMART Domains Protein: ENSMUSP00000037475
Gene: ENSMUSG00000024302
AA Change: C197*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 4.9e-43 PFAM
Pfam:EF-hand_3 144 232 7.8e-38 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115832
AA Change: C197*
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: C197*

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000220904
AA Change: C197*
Predicted Effect probably null
Transcript: ENSMUST00000221880
AA Change: C197*
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref T C 11: 120,598,248 R31G probably benign Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 probably null Het
Arhgap31 G T 16: 38,625,629 A118E probably damaging Het
Asb5 T A 8: 54,550,506 I21K probably damaging Het
Asxl2 A G 12: 3,496,760 I515V probably benign Het
Bend7 C T 2: 4,752,854 P236S probably benign Het
C330027C09Rik A G 16: 48,997,462 D65G probably damaging Het
C4bp T C 1: 130,639,087 T351A probably benign Het
Cd1d2 T A 3: 86,987,262 probably null Het
Chd1 T A 17: 15,761,404 D1368E probably benign Het
Chrnb3 A G 8: 27,393,654 I140V probably benign Het
Col6a2 T C 10: 76,596,791 T843A possibly damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Dopey1 A G 9: 86,494,457 D248G probably damaging Het
Flg2 T C 3: 93,220,083 S2101P unknown Het
Foxg1 A G 12: 49,384,646 H54R unknown Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr35 A G 1: 92,982,715 T50A probably damaging Het
Gsta3 A T 1: 21,260,098 Y108F probably benign Het
Hdac4 G T 1: 91,958,416 A811E probably damaging Het
Hephl1 A T 9: 15,060,914 V910E possibly damaging Het
Kcnb2 A T 1: 15,710,056 Y384F probably damaging Het
Kmt2a T C 9: 44,822,389 I2210M unknown Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lrriq1 A G 10: 103,156,335 probably null Het
Lsm4 G A 8: 70,678,368 G112S probably damaging Het
Myt1 T C 2: 181,822,761 probably null Het
Ndor1 T C 2: 25,248,734 R396G probably benign Het
Olfr1118 A C 2: 87,308,974 I82L probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prdm2 A G 4: 143,134,768 S651P probably benign Het
Prkaa2 T C 4: 105,051,975 M91V probably benign Het
Pskh1 G A 8: 105,913,594 R302H probably benign Het
Rab11fip4 A G 11: 79,686,589 T390A probably benign Het
Snx10 T C 6: 51,562,019 probably benign Het
Taar5 T C 10: 23,971,495 C264R probably damaging Het
Tcf20 A G 15: 82,852,937 C1438R probably benign Het
Tfap2d A G 1: 19,103,262 T3A probably benign Het
Toporsl A G 4: 52,609,975 probably benign Het
Trim71 A G 9: 114,513,124 S697P probably benign Het
Ufl1 T C 4: 25,269,057 D258G probably damaging Het
Vmn1r28 T C 6: 58,265,198 Y9H probably damaging Het
Zfp995 T A 17: 21,880,134 H373L probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23597488 missense probably benign 0.22
IGL01620:Dtna APN 18 23625087 missense probably damaging 1.00
IGL01705:Dtna APN 18 23545731 missense probably damaging 1.00
IGL01914:Dtna APN 18 23597459 missense possibly damaging 0.62
IGL02388:Dtna APN 18 23597514 missense probably benign 0.00
IGL02427:Dtna APN 18 23651538 missense possibly damaging 0.95
IGL03074:Dtna APN 18 23602605 missense possibly damaging 0.74
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0078:Dtna UTSW 18 23621442 missense probably damaging 1.00
R0390:Dtna UTSW 18 23597501 missense probably damaging 1.00
R1808:Dtna UTSW 18 23569640 missense probably damaging 1.00
R1872:Dtna UTSW 18 23597560 critical splice donor site probably null
R2095:Dtna UTSW 18 23569748 missense probably damaging 1.00
R2216:Dtna UTSW 18 23569565 missense probably damaging 1.00
R2295:Dtna UTSW 18 23631412 missense probably damaging 1.00
R2402:Dtna UTSW 18 23595478 nonsense probably null
R2846:Dtna UTSW 18 23651503 splice site probably null
R3836:Dtna UTSW 18 23625102 missense probably damaging 1.00
R4764:Dtna UTSW 18 23535149 splice site probably null
R4893:Dtna UTSW 18 23569667 missense probably damaging 0.99
R5194:Dtna UTSW 18 23590245 nonsense probably null
R5373:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5374:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5526:Dtna UTSW 18 23646230 missense probably damaging 0.99
R5755:Dtna UTSW 18 23621463 missense probably benign
R5769:Dtna UTSW 18 23651554 missense probably benign 0.27
R6062:Dtna UTSW 18 23622056 missense possibly damaging 0.87
R6413:Dtna UTSW 18 23622014 missense probably damaging 1.00
R6876:Dtna UTSW 18 23611110 missense probably benign 0.00
R7103:Dtna UTSW 18 23653379 critical splice donor site probably null
R7711:Dtna UTSW 18 23625196 critical splice donor site probably null
R7804:Dtna UTSW 18 23595609 missense probably damaging 0.97
R8437:Dtna UTSW 18 23590341 nonsense probably null
R8786:Dtna UTSW 18 23583133 missense probably benign 0.10
X0063:Dtna UTSW 18 23643168 missense probably damaging 0.98
X0066:Dtna UTSW 18 23592981 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TATCATGCTGAGACCATTTCCACAG -3'
(R):5'- CCTGAAATCTGGCTCTTGGC -3'

Sequencing Primer
(F):5'- CATTCTTTGTAACAGAGATCCTGAG -3'
(R):5'- TCTTGGCCAGTGAGTCCTCAG -3'
Posted On2020-06-30