Mutagenetix > Incidental Mutations

Incidental Mutation 'R8158:Abl2'

633341

Institutional Source

Beutler Lab

Gene Symbol

Abl2

Ensembl Gene

ENSMUSG00000026596

Gene Name

v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)

Synonyms

Abll, Arg

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.362) question?

Stock #

R8158 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156558786-156649568 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 156642069 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 968 (S968T)

Ref Sequence

ENSEMBL: ENSMUSP00000027888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172]

Predicted Effect

probably benign
Transcript: ENSMUST00000027888
AA Change: S968T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: S968T

Domain	Start	End	E-Value	Type
low complexity region	20	40	N/A	INTRINSIC
SH3	110	166	9.83e-16	SMART
SH2	171	254	1.34e-33	SMART
TyrKc	288	539	2.53e-148	SMART
low complexity region	561	577	N/A	INTRINSIC
low complexity region	598	609	N/A	INTRINSIC
low complexity region	734	752	N/A	INTRINSIC
low complexity region	877	891	N/A	INTRINSIC
low complexity region	974	991	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
FABD	1061	1182	5.24e-65	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166172
AA Change: S864T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: S864T

Domain	Start	End	E-Value	Type
low complexity region	20	40	N/A	INTRINSIC
SH3	110	166	9.83e-16	SMART
SH2	171	254	1.34e-33	SMART
TyrKc	288	539	2.53e-148	SMART
low complexity region	561	577	N/A	INTRINSIC
low complexity region	598	609	N/A	INTRINSIC
low complexity region	773	787	N/A	INTRINSIC
low complexity region	870	887	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC
FABD	957	1078	5.24e-65	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,665,056	D46V	probably damaging	Het
Adcy8	T	C	15: 64,783,806	D608G	probably benign	Het
Adgb	C	T	10: 10,378,734	V1162M	probably benign	Het
Agrn	A	G	4: 156,173,889	V1040A	probably benign	Het
Amer3	A	T	1: 34,587,660	T327S	possibly damaging	Het
Apaf1	C	T	10: 91,059,658	C426Y	probably benign	Het
Bsn	T	C	9: 108,110,033	D2840G	unknown	Het
Camsap1	A	T	2: 25,944,428	C406*	probably null	Het
Cbr2	A	T	11: 120,730,297	M158K	probably damaging	Het
Ccdc105	G	C	10: 78,748,675	Q338E	probably benign	Het
Cgrrf1	T	C	14: 46,853,735	S239P	probably benign	Het
Clnk	C	A	5: 38,794,911		probably null	Het
Csad	T	C	15: 102,177,762	M445V	probably damaging	Het
Dnajb7	T	A	15: 81,407,399	N246Y	probably damaging	Het
Dok6	T	C	18: 89,473,947	I169V	probably benign	Het
Hist1h2bm	T	C	13: 21,722,461	Y122H	probably benign	Het
Il1f10	T	G	2: 24,291,255	I11R	possibly damaging	Het
Irs1	C	T	1: 82,289,533	V321M	probably damaging	Het
Itga9	T	C	9: 118,877,143	F938L	probably damaging	Het
Kif7	T	C	7: 79,704,694	D781G	probably damaging	Het
Klhl41	A	T	2: 69,671,161	N322I	probably damaging	Het
Krtap31-1	T	G	11: 99,908,075	C35G	possibly damaging	Het
Lsm11	A	T	11: 45,933,997	D234E	probably benign	Het
Med6	T	C	12: 81,573,903	K223R	probably benign	Het
Mfsd4b2	G	A	10: 39,922,068	T97I	probably benign	Het
Mrgpra1	A	T	7: 47,335,456	C158*	probably null	Het
Nr2e1	T	C	10: 42,582,885	T8A	probably benign	Het
Oas2	T	C	5: 120,749,773	M1V	probably null	Het
Olfr1048	T	C	2: 86,236,160	Y218C	probably damaging	Het
Olfr1132	T	A	2: 87,634,889	N286I	probably damaging	Het
Olfr307	T	A	7: 86,335,677	I240F	probably benign	Het
Olfr393	T	A	11: 73,847,871	M85L	probably benign	Het
Olfr60	T	C	7: 140,345,249	I247V	probably benign	Het
Otof	C	T	5: 30,380,194	G1257D	probably benign	Het
Phf2	T	C	13: 48,817,760	T479A	probably benign	Het
Pik3c2a	T	C	7: 116,342,997	N1516S	probably benign	Het
Qrich1	C	A	9: 108,556,037	T622K	probably damaging	Het
Rasip1	A	G	7: 45,632,519	K482R	probably damaging	Het
Rgl2	T	C	17: 33,936,944	F698L	probably benign	Het
Scarb1	T	C	5: 125,303,137	D124G	probably benign	Het
Sclt1	A	G	3: 41,671,482	I350T	probably benign	Het
Sec23ip	T	G	7: 128,767,640	V696G	probably damaging	Het
Serpina1e	G	T	12: 103,951,095	T105K	probably benign	Het
Sin3a	A	G	9: 57,113,544		probably null	Het
Slc34a2	A	G	5: 53,060,840	T154A	probably damaging	Het
Slc9a3	T	C	13: 74,155,122	L178P	probably damaging	Het
Smarca2	A	C	19: 26,682,048	I913L	probably benign	Het
Tcea3	G	A	4: 136,273,716		probably null	Het
Tmcc1	T	A	6: 116,043,474	H339L		Het
Trpm2	G	T	10: 77,947,897	H247Q	probably damaging	Het
Tyr	T	A	7: 87,472,516	D356V	probably damaging	Het
Vmn2r54	A	T	7: 12,615,961	C565S	probably damaging	Het
Vmn2r82	A	C	10: 79,377,802	N74T	probably benign	Het
Zcchc4	T	C	5: 52,815,918	Y375H	probably damaging	Het
Zfhx3	T	A	8: 108,948,721	D2134E	possibly damaging	Het
Zfhx4	T	A	3: 5,398,950	Y1414*	probably null	Het
Zfp282	A	T	6: 47,890,692	E267D	possibly damaging	Het
Zfp442	A	T	2: 150,409,176	C269S	possibly damaging	Het
Zp3	T	A	5: 135,985,564	S246T	probably benign	Het

Other mutations in Abl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01400:Abl2	APN	1	156635184	missense	probably damaging	1.00
IGL01679:Abl2	APN	1	156642465	missense	probably benign	0.01
IGL02289:Abl2	APN	1	156629854	missense	probably damaging	1.00
PIT4495001:Abl2	UTSW	1	156633185	missense	probably damaging	1.00
R0907:Abl2	UTSW	1	156629859	missense	probably damaging	1.00
R1232:Abl2	UTSW	1	156641730	missense	probably damaging	1.00
R2069:Abl2	UTSW	1	156620827	splice site	probably null
R4224:Abl2	UTSW	1	156633847	missense	probably damaging	0.98
R4305:Abl2	UTSW	1	156641563	missense	probably damaging	0.99
R4411:Abl2	UTSW	1	156630082	missense	possibly damaging	0.86
R4490:Abl2	UTSW	1	156633779	missense	probably damaging	1.00
R5132:Abl2	UTSW	1	156641832	nonsense	probably null
R5383:Abl2	UTSW	1	156642232	missense	possibly damaging	0.89
R5428:Abl2	UTSW	1	156642111	missense	probably damaging	1.00
R5436:Abl2	UTSW	1	156629880	missense	probably damaging	1.00
R5760:Abl2	UTSW	1	156641857	missense	probably benign	0.06
R6051:Abl2	UTSW	1	156642085	missense	probably damaging	1.00
R6955:Abl2	UTSW	1	156622649	missense	probably damaging	1.00
R7002:Abl2	UTSW	1	156559133	missense	probably damaging	1.00
R7038:Abl2	UTSW	1	156641409	missense	possibly damaging	0.95
R7172:Abl2	UTSW	1	156622587	missense	probably damaging	1.00
R7268:Abl2	UTSW	1	156633939	critical splice donor site	probably null
R7282:Abl2	UTSW	1	156630060	missense	probably damaging	1.00
R7303:Abl2	UTSW	1	156641250	missense	probably benign	0.00
R7372:Abl2	UTSW	1	156622619	missense	probably damaging	1.00
R7375:Abl2	UTSW	1	156622614	missense	probably damaging	1.00
R7443:Abl2	UTSW	1	156625381	missense	probably damaging	1.00
R7468:Abl2	UTSW	1	156622534	missense	possibly damaging	0.68
R7614:Abl2	UTSW	1	156636859	missense	possibly damaging	0.71
R7644:Abl2	UTSW	1	156615993	missense	probably benign	0.08
R7783:Abl2	UTSW	1	156559071	missense	probably benign
X0067:Abl2	UTSW	1	156631433	splice site	probably null
Z1177:Abl2	UTSW	1	156641106	missense	probably damaging	1.00
Z1177:Abl2	UTSW	1	156641553	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGATCCAGCCATCACAGAGAG -3'
(R):5'- ACTTGAGGTGGAGGCATGAC -3'

Sequencing Primer
(F):5'- AGAGTGACTCTCCGGGGGTAG -3'
(R):5'- CACTACTGGGCATTGGGC -3'

Posted On

2020-06-30