Incidental Mutation 'R8158:Abl2'
ID633341
Institutional Source Beutler Lab
Gene Symbol Abl2
Ensembl Gene ENSMUSG00000026596
Gene Namev-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
SynonymsAbll, Arg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156558786-156649568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156642069 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 968 (S968T)
Ref Sequence ENSEMBL: ENSMUSP00000027888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172]
Predicted Effect probably benign
Transcript: ENSMUST00000027888
AA Change: S968T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: S968T

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
low complexity region 877 891 N/A INTRINSIC
low complexity region 974 991 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
FABD 1061 1182 5.24e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166172
AA Change: S864T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: S864T

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 773 787 N/A INTRINSIC
low complexity region 870 887 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
FABD 957 1078 5.24e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Abl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Abl2 APN 1 156635184 missense probably damaging 1.00
IGL01679:Abl2 APN 1 156642465 missense probably benign 0.01
IGL02289:Abl2 APN 1 156629854 missense probably damaging 1.00
PIT4495001:Abl2 UTSW 1 156633185 missense probably damaging 1.00
R0907:Abl2 UTSW 1 156629859 missense probably damaging 1.00
R1232:Abl2 UTSW 1 156641730 missense probably damaging 1.00
R2069:Abl2 UTSW 1 156620827 splice site probably null
R4224:Abl2 UTSW 1 156633847 missense probably damaging 0.98
R4305:Abl2 UTSW 1 156641563 missense probably damaging 0.99
R4411:Abl2 UTSW 1 156630082 missense possibly damaging 0.86
R4490:Abl2 UTSW 1 156633779 missense probably damaging 1.00
R5132:Abl2 UTSW 1 156641832 nonsense probably null
R5383:Abl2 UTSW 1 156642232 missense possibly damaging 0.89
R5428:Abl2 UTSW 1 156642111 missense probably damaging 1.00
R5436:Abl2 UTSW 1 156629880 missense probably damaging 1.00
R5760:Abl2 UTSW 1 156641857 missense probably benign 0.06
R6051:Abl2 UTSW 1 156642085 missense probably damaging 1.00
R6955:Abl2 UTSW 1 156622649 missense probably damaging 1.00
R7002:Abl2 UTSW 1 156559133 missense probably damaging 1.00
R7038:Abl2 UTSW 1 156641409 missense possibly damaging 0.95
R7172:Abl2 UTSW 1 156622587 missense probably damaging 1.00
R7268:Abl2 UTSW 1 156633939 critical splice donor site probably null
R7282:Abl2 UTSW 1 156630060 missense probably damaging 1.00
R7303:Abl2 UTSW 1 156641250 missense probably benign 0.00
R7372:Abl2 UTSW 1 156622619 missense probably damaging 1.00
R7375:Abl2 UTSW 1 156622614 missense probably damaging 1.00
R7443:Abl2 UTSW 1 156625381 missense probably damaging 1.00
R7468:Abl2 UTSW 1 156622534 missense possibly damaging 0.68
R7614:Abl2 UTSW 1 156636859 missense possibly damaging 0.71
R7644:Abl2 UTSW 1 156615993 missense probably benign 0.08
R7783:Abl2 UTSW 1 156559071 missense probably benign
X0067:Abl2 UTSW 1 156631433 splice site probably null
Z1177:Abl2 UTSW 1 156641106 missense probably damaging 1.00
Z1177:Abl2 UTSW 1 156641553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGATCCAGCCATCACAGAGAG -3'
(R):5'- ACTTGAGGTGGAGGCATGAC -3'

Sequencing Primer
(F):5'- AGAGTGACTCTCCGGGGGTAG -3'
(R):5'- CACTACTGGGCATTGGGC -3'
Posted On2020-06-30