Incidental Mutation 'R8158:Klhl41'
ID633344
Institutional Source Beutler Lab
Gene Symbol Klhl41
Ensembl Gene ENSMUSG00000075307
Gene Namekelch-like 41
SynonymsLOC228003, Kbtbd10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69670120-69684230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69671161 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 322 (N322I)
Ref Sequence ENSEMBL: ENSMUSP00000097627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074963] [ENSMUST00000100050] [ENSMUST00000112286] [ENSMUST00000134659]
Predicted Effect probably benign
Transcript: ENSMUST00000074963
SMART Domains Protein: ENSMUSP00000074494
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 7 339 6.2e-161 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100050
AA Change: N322I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: N322I

DomainStartEndE-ValueType
BTB 33 130 8.34e-27 SMART
BACK 135 237 9.67e-36 SMART
Kelch 346 398 6.71e-1 SMART
Kelch 399 447 1.56e-5 SMART
Kelch 448 495 2.43e-7 SMART
Kelch 496 542 5.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112286
SMART Domains Protein: ENSMUSP00000107905
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 208 1.6e-100 PFAM
Pfam:DUF1448 206 319 9.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127806
SMART Domains Protein: ENSMUSP00000121691
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 22 90 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134659
SMART Domains Protein: ENSMUSP00000119377
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 88 3.1e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Klhl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Klhl41 APN 2 69674724 missense probably benign 0.00
IGL01622:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL01623:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL03237:Klhl41 APN 2 69670558 missense possibly damaging 0.94
R0220:Klhl41 UTSW 2 69670485 missense probably benign 0.25
R0277:Klhl41 UTSW 2 69671296 missense probably damaging 1.00
R0456:Klhl41 UTSW 2 69670549 missense probably damaging 0.99
R0485:Klhl41 UTSW 2 69671256 missense probably damaging 0.97
R0536:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0537:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0552:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0553:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0834:Klhl41 UTSW 2 69678147 missense possibly damaging 0.76
R0879:Klhl41 UTSW 2 69683483 unclassified probably benign
R1531:Klhl41 UTSW 2 69670740 missense probably benign 0.03
R1678:Klhl41 UTSW 2 69670939 missense probably benign 0.01
R1792:Klhl41 UTSW 2 69670802 missense probably benign 0.01
R1900:Klhl41 UTSW 2 69674619 splice site probably benign
R2012:Klhl41 UTSW 2 69683496 missense possibly damaging 0.61
R4041:Klhl41 UTSW 2 69670710 missense probably benign 0.00
R5223:Klhl41 UTSW 2 69679827 nonsense probably null
R5500:Klhl41 UTSW 2 69683529 missense probably damaging 1.00
R5643:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5644:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5656:Klhl41 UTSW 2 69683532 missense possibly damaging 0.89
R6264:Klhl41 UTSW 2 69679832 critical splice donor site probably null
R6678:Klhl41 UTSW 2 69670844 missense probably benign 0.04
R6731:Klhl41 UTSW 2 69674700 missense probably damaging 1.00
R7586:Klhl41 UTSW 2 69674724 missense probably benign 0.33
R7664:Klhl41 UTSW 2 69670717 missense probably damaging 1.00
R8341:Klhl41 UTSW 2 69670524 missense probably benign 0.07
X0021:Klhl41 UTSW 2 69679706 missense probably damaging 1.00
Z1088:Klhl41 UTSW 2 69674730 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TTTTGCAGGCAAACTTCCGG -3'
(R):5'- CATGTGAACAGTATGTAAACACCCC -3'

Sequencing Primer
(F):5'- GGCAAACTTCCGGAACCCAG -3'
(R):5'- TAGCTAATGGTAGTGACCCTCAC -3'
Posted On2020-06-30