Incidental Mutation 'R8158:Zfp442'
ID633347
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150409176 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 269 (C269S)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109916
AA Change: C269S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: C269S

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: C268S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: C268S

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8192:Zfp442 UTSW 2 150408709 missense unknown
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTTCTTTTATGATACAGGAGACT -3'
(R):5'- TCAAAGAACGCATACTGGAGAG -3'

Sequencing Primer
(F):5'- CTTTGATGCCTTCGAAGATGACAGC -3'
(R):5'- CGCATACTGGAGAGAAACCTTATG -3'
Posted On2020-06-30