Mutagenetix > Incidental Mutation

Incidental Mutation 'R8158:Sclt1'

633349

Institutional Source

Beutler Lab

Gene Symbol

Sclt1

Ensembl Gene

ENSMUSG00000059834

Gene Name

sodium channel and clathrin linker 1

Synonyms

2610207F23Rik, 4931421F20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R8158 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41626720-41742514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41671482 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 350 (I350T)

Ref Sequence

ENSEMBL: ENSMUSP00000026866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]

AlphaFold

G5E861

Predicted Effect

probably benign
Transcript: ENSMUST00000026866
AA Change: I350T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834
AA Change: I350T

Domain	Start	End	E-Value	Type
coiled coil region	59	105	N/A	INTRINSIC
internal_repeat_1	166	179	6.29e-5	PROSPERO
coiled coil region	372	543	N/A	INTRINSIC
internal_repeat_1	555	568	6.29e-5	PROSPERO
coiled coil region	571	675	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146125

Predicted Effect

probably benign
Transcript: ENSMUST00000148769

SMART Domains

Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

Domain	Start	End	E-Value	Type
coiled coil region	59	105	N/A	INTRINSIC
coiled coil region	178	333	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,665,056	D46V	probably damaging	Het
Abl2	T	A	1: 156,642,069	S968T	probably benign	Het
Adcy8	T	C	15: 64,783,806	D608G	probably benign	Het
Adgb	C	T	10: 10,378,734	V1162M	probably benign	Het
Agrn	A	G	4: 156,173,889	V1040A	probably benign	Het
Amer3	A	T	1: 34,587,660	T327S	possibly damaging	Het
Apaf1	C	T	10: 91,059,658	C426Y	probably benign	Het
Bsn	T	C	9: 108,110,033	D2840G	unknown	Het
Camsap1	A	T	2: 25,944,428	C406*	probably null	Het
Cbr2	A	T	11: 120,730,297	M158K	probably damaging	Het
Ccdc105	G	C	10: 78,748,675	Q338E	probably benign	Het
Cgrrf1	T	C	14: 46,853,735	S239P	probably benign	Het
Clnk	C	A	5: 38,794,911		probably null	Het
Csad	T	C	15: 102,177,762	M445V	probably damaging	Het
Dnajb7	T	A	15: 81,407,399	N246Y	probably damaging	Het
Dok6	T	C	18: 89,473,947	I169V	probably benign	Het
Hist1h2bm	T	C	13: 21,722,461	Y122H	probably benign	Het
Il1f10	T	G	2: 24,291,255	I11R	possibly damaging	Het
Irs1	C	T	1: 82,289,533	V321M	probably damaging	Het
Itga9	T	C	9: 118,877,143	F938L	probably damaging	Het
Kif7	T	C	7: 79,704,694	D781G	probably damaging	Het
Klhl41	A	T	2: 69,671,161	N322I	probably damaging	Het
Krtap31-1	T	G	11: 99,908,075	C35G	possibly damaging	Het
Lsm11	A	T	11: 45,933,997	D234E	probably benign	Het
Med6	T	C	12: 81,573,903	K223R	probably benign	Het
Mfsd4b2	G	A	10: 39,922,068	T97I	probably benign	Het
Mrgpra1	A	T	7: 47,335,456	C158*	probably null	Het
Nr2e1	T	C	10: 42,582,885	T8A	probably benign	Het
Oas2	T	C	5: 120,749,773	M1V	probably null	Het
Olfr1048	T	C	2: 86,236,160	Y218C	probably damaging	Het
Olfr1132	T	A	2: 87,634,889	N286I	probably damaging	Het
Olfr307	T	A	7: 86,335,677	I240F	probably benign	Het
Olfr393	T	A	11: 73,847,871	M85L	probably benign	Het
Olfr60	T	C	7: 140,345,249	I247V	probably benign	Het
Otof	C	T	5: 30,380,194	G1257D	probably benign	Het
Phf2	T	C	13: 48,817,760	T479A	probably benign	Het
Pik3c2a	T	C	7: 116,342,997	N1516S	probably benign	Het
Qrich1	C	A	9: 108,556,037	T622K	probably damaging	Het
Rasip1	A	G	7: 45,632,519	K482R	probably damaging	Het
Rgl2	T	C	17: 33,936,944	F698L	probably benign	Het
Scarb1	T	C	5: 125,303,137	D124G	probably benign	Het
Sec23ip	T	G	7: 128,767,640	V696G	probably damaging	Het
Serpina1e	G	T	12: 103,951,095	T105K	probably benign	Het
Sin3a	A	G	9: 57,113,544		probably null	Het
Slc34a2	A	G	5: 53,060,840	T154A	probably damaging	Het
Slc9a3	T	C	13: 74,155,122	L178P	probably damaging	Het
Smarca2	A	C	19: 26,682,048	I913L	probably benign	Het
Tcea3	G	A	4: 136,273,716		probably null	Het
Tmcc1	T	A	6: 116,043,474	H339L		Het
Trpm2	G	T	10: 77,947,897	H247Q	probably damaging	Het
Tyr	T	A	7: 87,472,516	D356V	probably damaging	Het
Vmn2r54	A	T	7: 12,615,961	C565S	probably damaging	Het
Vmn2r82	A	C	10: 79,377,802	N74T	probably benign	Het
Zcchc4	T	C	5: 52,815,918	Y375H	probably damaging	Het
Zfhx3	T	A	8: 108,948,721	D2134E	possibly damaging	Het
Zfhx4	T	A	3: 5,398,950	Y1414*	probably null	Het
Zfp282	A	T	6: 47,890,692	E267D	possibly damaging	Het
Zfp442	A	T	2: 150,409,176	C269S	possibly damaging	Het
Zp3	T	A	5: 135,985,564	S246T	probably benign	Het

Other mutations in Sclt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Sclt1	APN	3	41741991	unclassified	probably benign
IGL01106:Sclt1	APN	3	41675319	splice site	probably benign
IGL01368:Sclt1	APN	3	41711175	missense	probably damaging	0.96
IGL02001:Sclt1	APN	3	41681721	missense	possibly damaging	0.63
IGL02897:Sclt1	APN	3	41675387	missense	probably benign	0.01
IGL03066:Sclt1	APN	3	41717843	missense	probably benign	0.00
R0038:Sclt1	UTSW	3	41629508	splice site	probably benign
R0038:Sclt1	UTSW	3	41629508	splice site	probably benign
R0172:Sclt1	UTSW	3	41717787	missense	possibly damaging	0.84
R0359:Sclt1	UTSW	3	41661570	critical splice donor site	probably null
R1281:Sclt1	UTSW	3	41647620	missense	probably benign	0.01
R1831:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R1832:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R1833:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R2027:Sclt1	UTSW	3	41730888	missense	probably benign	0.00
R4578:Sclt1	UTSW	3	41671465	nonsense	probably null
R5502:Sclt1	UTSW	3	41657275	missense	probably benign	0.28
R5558:Sclt1	UTSW	3	41661590	missense	probably benign	0.14
R5601:Sclt1	UTSW	3	41730919	missense	probably benign
R5710:Sclt1	UTSW	3	41663963	nonsense	probably null
R6041:Sclt1	UTSW	3	41627177	missense	probably damaging	0.99
R6274:Sclt1	UTSW	3	41629516	critical splice donor site	probably null
R6765:Sclt1	UTSW	3	41730902	missense	unknown
R7171:Sclt1	UTSW	3	41717760	missense	probably benign	0.00
R7489:Sclt1	UTSW	3	41629597	missense	probably damaging	0.99
R7988:Sclt1	UTSW	3	41663454	makesense	probably null
R8040:Sclt1	UTSW	3	41657376	missense	probably damaging	1.00
R8383:Sclt1	UTSW	3	41742015	missense	probably benign	0.13
R8956:Sclt1	UTSW	3	41681774	missense	probably benign	0.01
R8971:Sclt1	UTSW	3	41727106	missense	probably benign	0.01
R9227:Sclt1	UTSW	3	41711196	missense	probably benign	0.01
R9230:Sclt1	UTSW	3	41711196	missense	probably benign	0.01
R9463:Sclt1	UTSW	3	41647496	missense	probably damaging	1.00
R9729:Sclt1	UTSW	3	41675402	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCCACTGTTTATGAAGCC -3'
(R):5'- CCTGGGACTTTGAGTTGTCAAG -3'

Sequencing Primer
(F):5'- CCACTGTTTATGAAGCCAAAGAC -3'
(R):5'- CTGGGACTTTGAGTTGTCAAGATAAG -3'

Posted On

2020-06-30