Incidental Mutation 'R8158:Sclt1'
ID633349
Institutional Source Beutler Lab
Gene Symbol Sclt1
Ensembl Gene ENSMUSG00000059834
Gene Namesodium channel and clathrin linker 1
Synonyms2610207F23Rik, 4931421F20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location41626720-41742514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41671482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 350 (I350T)
Ref Sequence ENSEMBL: ENSMUSP00000026866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]
Predicted Effect probably benign
Transcript: ENSMUST00000026866
AA Change: I350T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834
AA Change: I350T

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
internal_repeat_1 166 179 6.29e-5 PROSPERO
coiled coil region 372 543 N/A INTRINSIC
internal_repeat_1 555 568 6.29e-5 PROSPERO
coiled coil region 571 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146125
Predicted Effect probably benign
Transcript: ENSMUST00000148769
SMART Domains Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
coiled coil region 178 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Sclt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sclt1 APN 3 41741991 unclassified probably benign
IGL01106:Sclt1 APN 3 41675319 splice site probably benign
IGL01368:Sclt1 APN 3 41711175 missense probably damaging 0.96
IGL02001:Sclt1 APN 3 41681721 missense possibly damaging 0.63
IGL02897:Sclt1 APN 3 41675387 missense probably benign 0.01
IGL03066:Sclt1 APN 3 41717843 missense probably benign 0.00
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0172:Sclt1 UTSW 3 41717787 missense possibly damaging 0.84
R0359:Sclt1 UTSW 3 41661570 critical splice donor site probably null
R1281:Sclt1 UTSW 3 41647620 missense probably benign 0.01
R1831:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1832:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1833:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R2027:Sclt1 UTSW 3 41730888 missense probably benign 0.00
R4578:Sclt1 UTSW 3 41671465 nonsense probably null
R5502:Sclt1 UTSW 3 41657275 missense probably benign 0.28
R5558:Sclt1 UTSW 3 41661590 missense probably benign 0.14
R5601:Sclt1 UTSW 3 41730919 missense probably benign
R5710:Sclt1 UTSW 3 41663963 nonsense probably null
R6041:Sclt1 UTSW 3 41627177 missense probably damaging 0.99
R6274:Sclt1 UTSW 3 41629516 critical splice donor site probably null
R6765:Sclt1 UTSW 3 41730902 missense unknown
R7171:Sclt1 UTSW 3 41717760 missense probably benign 0.00
R7489:Sclt1 UTSW 3 41629597 missense probably damaging 0.99
R8040:Sclt1 UTSW 3 41657376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCACTGTTTATGAAGCC -3'
(R):5'- CCTGGGACTTTGAGTTGTCAAG -3'

Sequencing Primer
(F):5'- CCACTGTTTATGAAGCCAAAGAC -3'
(R):5'- CTGGGACTTTGAGTTGTCAAGATAAG -3'
Posted On2020-06-30