Incidental Mutation 'R8158:Slc34a2'
ID633355
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Namesolute carrier family 34 (sodium phosphate), member 2
SynonymsD5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission
Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53038081-53071664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53060840 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000092380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787] [ENSMUST00000170523]
Predicted Effect probably damaging
Transcript: ENSMUST00000094787
AA Change: T154A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: T154A

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170523
AA Change: T154A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130692
Gene: ENSMUSG00000029188
AA Change: T154A

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 187 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53069286 missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53069182 missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53069339 missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53069380 missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53069134 missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8364:Slc34a2 UTSW 5 53068374 missense possibly damaging 0.75
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCCTACTCTACAGCCAGC -3'
(R):5'- TGGTACTCCCATCTCACAGG -3'

Sequencing Primer
(F):5'- AGCTGGCCTGGTGTGGAC -3'
(R):5'- TCTCACAGGAGGCCAGGAATC -3'
Posted On2020-06-30