Incidental Mutation 'R8158:Oas2'
ID633356
Institutional Source Beutler Lab
Gene Symbol Oas2
Ensembl Gene ENSMUSG00000032690
Gene Name2'-5' oligoadenylate synthetase 2
Synonyms2'-5' oligoadenylate synthetase-like 11, Oasl11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location120730333-120749853 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 120749773 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000080209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000053909] [ENSMUST00000081491] [ENSMUST00000165820]
Predicted Effect probably benign
Transcript: ENSMUST00000044833
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053909
AA Change: M1V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000060082
Gene: ENSMUSG00000032690
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 190 378 5.6e-75 PFAM
Pfam:NTP_transf_2 412 516 4e-9 PFAM
Pfam:OAS1_C 533 724 3.2e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081491
AA Change: M1V
SMART Domains Protein: ENSMUSP00000080209
Gene: ENSMUSG00000032690
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 191 376 1.9e-77 PFAM
Pfam:NTP_transf_2 412 516 1.3e-10 PFAM
Pfam:OAS1_C 534 722 2.6e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165820
SMART Domains Protein: ENSMUSP00000125873
Gene: ENSMUSG00000032661

DomainStartEndE-ValueType
Pfam:OAS1_C 1 130 3.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: In nursing mothers, homozygous knockout (by a point mutation in a critical domain) results in a failure of the alveoli to expand and a failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Oas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL00784:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL01388:Oas2 APN 5 120748592 missense probably damaging 1.00
IGL01643:Oas2 APN 5 120736187 splice site probably benign
IGL01660:Oas2 APN 5 120741223 missense probably benign 0.00
IGL02346:Oas2 APN 5 120736088 missense probably benign 0.30
IGL02403:Oas2 APN 5 120748750 missense possibly damaging 0.59
IGL03297:Oas2 APN 5 120735085 missense possibly damaging 0.91
R0149:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0344:Oas2 UTSW 5 120743087 missense probably damaging 1.00
R0361:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0387:Oas2 UTSW 5 120745672 splice site probably benign
R0465:Oas2 UTSW 5 120735055 missense probably damaging 0.99
R2100:Oas2 UTSW 5 120745675 critical splice donor site probably null
R2324:Oas2 UTSW 5 120743274 missense probably benign 0.43
R2496:Oas2 UTSW 5 120748617 missense probably benign 0.00
R4357:Oas2 UTSW 5 120738669 critical splice donor site probably null
R4466:Oas2 UTSW 5 120749602 missense probably damaging 0.99
R4472:Oas2 UTSW 5 120741155 missense possibly damaging 0.81
R4632:Oas2 UTSW 5 120733481 missense probably benign 0.34
R4714:Oas2 UTSW 5 120733472 missense probably damaging 1.00
R4824:Oas2 UTSW 5 120738346 missense probably benign 0.32
R4872:Oas2 UTSW 5 120738534 missense probably damaging 1.00
R5629:Oas2 UTSW 5 120738451 nonsense probably null
R6351:Oas2 UTSW 5 120748538 missense probably benign
R6463:Oas2 UTSW 5 120734981 missense probably null 1.00
R6488:Oas2 UTSW 5 120738363 missense probably damaging 1.00
R6787:Oas2 UTSW 5 120738798 missense possibly damaging 0.77
R6945:Oas2 UTSW 5 120736139 missense probably benign 0.00
R7353:Oas2 UTSW 5 120738522 missense probably damaging 1.00
R7459:Oas2 UTSW 5 120749710 missense unknown
R7634:Oas2 UTSW 5 120733228 missense probably benign 0.18
R7639:Oas2 UTSW 5 120745686 nonsense probably null
R7958:Oas2 UTSW 5 120748766 missense probably benign 0.00
R7968:Oas2 UTSW 5 120738372 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACCGCAATCTGCTTCAGAC -3'
(R):5'- AAGTTTAAGCTGGGGTGTCC -3'

Sequencing Primer
(F):5'- GCAATCTGCTTCAGACAGTTTTCG -3'
(R):5'- AGCTGCTGGGAAGTAACTCC -3'
Posted On2020-06-30