Incidental Mutation 'R8158:Zp3'
ID633358
Institutional Source Beutler Lab
Gene Symbol Zp3
Ensembl Gene ENSMUSG00000004948
Gene Namezona pellucida glycoprotein 3
SynonymsZp-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135980099-135988624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135985564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 246 (S246T)
Ref Sequence ENSEMBL: ENSMUSP00000005073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005073]
PDB Structure
ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005073
AA Change: S246T

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: S246T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
ZP 45 304 1.22e-68 SMART
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131563
SMART Domains Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948

DomainStartEndE-ValueType
Pfam:Zona_pellucida 35 136 6.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Other mutations in Zp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zp3 APN 5 135984351 missense possibly damaging 0.72
IGL02563:Zp3 APN 5 135987610 critical splice donor site probably null
IGL03185:Zp3 APN 5 135982721 missense possibly damaging 0.94
PIT4280001:Zp3 UTSW 5 135984464 missense possibly damaging 0.56
R0646:Zp3 UTSW 5 135984356 missense possibly damaging 0.46
R1454:Zp3 UTSW 5 135984188 missense probably damaging 1.00
R1691:Zp3 UTSW 5 135980281 missense possibly damaging 0.86
R3415:Zp3 UTSW 5 135985660 missense probably benign 0.07
R4599:Zp3 UTSW 5 135984235 nonsense probably null
R4987:Zp3 UTSW 5 135987505 nonsense probably null
R5907:Zp3 UTSW 5 135988523 missense probably benign 0.00
R6388:Zp3 UTSW 5 135982694 missense probably benign 0.02
R6587:Zp3 UTSW 5 135987498 missense possibly damaging 0.68
R6629:Zp3 UTSW 5 135987336 missense probably benign 0.00
R7438:Zp3 UTSW 5 135982705 missense probably damaging 1.00
R8050:Zp3 UTSW 5 135982750 missense probably damaging 1.00
R8083:Zp3 UTSW 5 135984522 missense probably damaging 1.00
R8421:Zp3 UTSW 5 135988477 missense probably benign 0.00
R8447:Zp3 UTSW 5 135984390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCCTGATCTCGGTAACTTG -3'
(R):5'- AGAGGTTCAGGCTTAGGCTC -3'

Sequencing Primer
(F):5'- CCTGGAACTTACTTTGTAGACCAGG -3'
(R):5'- TTCAGGCTTAGGCTCCGCAC -3'
Posted On2020-06-30