Incidental Mutation 'R8158:Vmn2r54'
ID633361
Institutional Source Beutler Lab
Gene Symbol Vmn2r54
Ensembl Gene ENSMUSG00000096593
Gene Namevomeronasal 2, receptor 54
SynonymsEG666085, Gm470, LOC232871, LOC385080
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12615233-12636134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12615961 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 565 (C565S)
Ref Sequence ENSEMBL: ENSMUSP00000083386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086210]
Predicted Effect probably damaging
Transcript: ENSMUST00000086210
AA Change: C565S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593
AA Change: C565S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 4.3e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 1.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Vmn2r54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn2r54 APN 7 12631913 splice site probably benign
IGL01778:Vmn2r54 APN 7 12632082 missense probably benign 0.07
IGL01998:Vmn2r54 APN 7 12615300 missense probably benign
IGL02028:Vmn2r54 APN 7 12632161 missense probably damaging 1.00
IGL02064:Vmn2r54 APN 7 12615606 missense probably benign 0.02
IGL02238:Vmn2r54 APN 7 12635983 missense probably damaging 1.00
IGL03062:Vmn2r54 APN 7 12632428 missense probably damaging 0.98
IGL03120:Vmn2r54 APN 7 12615387 missense probably damaging 1.00
PIT4453001:Vmn2r54 UTSW 7 12629742 missense probably benign 0.06
R0212:Vmn2r54 UTSW 7 12632497 missense probably benign
R0360:Vmn2r54 UTSW 7 12615649 missense probably damaging 1.00
R1646:Vmn2r54 UTSW 7 12632507 missense probably damaging 1.00
R1673:Vmn2r54 UTSW 7 12616211 critical splice acceptor site probably null
R1738:Vmn2r54 UTSW 7 12635888 missense probably benign 0.00
R1856:Vmn2r54 UTSW 7 12632311 missense probably benign
R2012:Vmn2r54 UTSW 7 12615877 missense probably damaging 1.00
R2038:Vmn2r54 UTSW 7 12629710 missense possibly damaging 0.94
R2160:Vmn2r54 UTSW 7 12615493 missense probably benign 0.29
R2397:Vmn2r54 UTSW 7 12615651 missense probably damaging 0.98
R2430:Vmn2r54 UTSW 7 12632006 missense probably damaging 0.99
R2829:Vmn2r54 UTSW 7 12615690 missense possibly damaging 0.62
R2975:Vmn2r54 UTSW 7 12635992 missense possibly damaging 0.92
R3005:Vmn2r54 UTSW 7 12615294 missense probably benign 0.28
R3725:Vmn2r54 UTSW 7 12632296 missense probably benign 0.42
R4486:Vmn2r54 UTSW 7 12632272 nonsense probably null
R4881:Vmn2r54 UTSW 7 12629671 missense probably benign 0.00
R4907:Vmn2r54 UTSW 7 12616223 splice site probably null
R5536:Vmn2r54 UTSW 7 12632416 missense probably benign 0.03
R5637:Vmn2r54 UTSW 7 12615369 missense probably benign 0.41
R5703:Vmn2r54 UTSW 7 12629667 missense probably benign 0.22
R5769:Vmn2r54 UTSW 7 12615282 missense possibly damaging 0.73
R5972:Vmn2r54 UTSW 7 12615352 missense probably damaging 1.00
R5972:Vmn2r54 UTSW 7 12635947 missense probably damaging 1.00
R5977:Vmn2r54 UTSW 7 12632216 missense probably damaging 1.00
R6084:Vmn2r54 UTSW 7 12632278 missense probably damaging 0.98
R6176:Vmn2r54 UTSW 7 12615981 missense probably damaging 1.00
R6229:Vmn2r54 UTSW 7 12631956 missense probably benign 0.00
R6371:Vmn2r54 UTSW 7 12615435 missense probably damaging 1.00
R6374:Vmn2r54 UTSW 7 12615493 missense probably damaging 1.00
R6804:Vmn2r54 UTSW 7 12629865 missense probably benign
R6886:Vmn2r54 UTSW 7 12632153 missense probably benign 0.02
R7041:Vmn2r54 UTSW 7 12629824 missense probably damaging 0.99
R7058:Vmn2r54 UTSW 7 12615795 missense possibly damaging 0.70
R7113:Vmn2r54 UTSW 7 12616074 missense probably damaging 1.00
R7124:Vmn2r54 UTSW 7 12622151 missense probably benign 0.00
R7126:Vmn2r54 UTSW 7 12632161 missense possibly damaging 0.91
R7236:Vmn2r54 UTSW 7 12631990 missense possibly damaging 0.84
R7337:Vmn2r54 UTSW 7 12622117 missense probably benign 0.00
R7406:Vmn2r54 UTSW 7 12616223 splice site probably null
R7634:Vmn2r54 UTSW 7 12615703 missense probably damaging 1.00
R7793:Vmn2r54 UTSW 7 12632269 missense probably damaging 0.98
R8139:Vmn2r54 UTSW 7 12615816 missense possibly damaging 0.92
R8179:Vmn2r54 UTSW 7 12632091 nonsense probably null
U24488:Vmn2r54 UTSW 7 12615429 missense possibly damaging 0.84
X0066:Vmn2r54 UTSW 7 12615370 missense probably damaging 1.00
Z1177:Vmn2r54 UTSW 7 12632108 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGATCCTACTTCGTGGTC -3'
(R):5'- AAGAGATGTCTTCTGTGCCC -3'

Sequencing Primer
(F):5'- TCTGGTGACTCTGAAGGCCAG -3'
(R):5'- AGATGTCTTCTGTGCCCCAAGG -3'
Posted On2020-06-30