Incidental Mutation 'R8158:Olfr307'
ID633365
Institutional Source Beutler Lab
Gene Symbol Olfr307
Ensembl Gene ENSMUSG00000055610
Gene Nameolfactory receptor 307
SynonymsMOR219-1, GA_x6K02T2NHDJ-9772012-9772953
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86332176-86337586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86335677 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 240 (I240F)
Ref Sequence ENSEMBL: ENSMUSP00000151140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069279] [ENSMUST00000213705] [ENSMUST00000217494]
Predicted Effect probably benign
Transcript: ENSMUST00000069279
AA Change: I240F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063538
Gene: ENSMUSG00000055610
AA Change: I240F

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:7tm_4 29 306 1.6e-42 PFAM
Pfam:7tm_1 39 288 9.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213705
AA Change: I240F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217494
AA Change: I240F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Olfr307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr307 APN 7 86336061 missense probably benign 0.00
IGL02419:Olfr307 APN 7 86335662 missense probably damaging 0.98
IGL02519:Olfr307 APN 7 86335581 missense probably benign 0.01
IGL02750:Olfr307 APN 7 86335544 missense probably damaging 1.00
R0123:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0134:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0225:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R1025:Olfr307 UTSW 7 86335905 missense probably benign 0.09
R1511:Olfr307 UTSW 7 86336345 missense possibly damaging 0.49
R1674:Olfr307 UTSW 7 86335557 missense probably damaging 1.00
R2011:Olfr307 UTSW 7 86335747 nonsense probably null
R4588:Olfr307 UTSW 7 86335644 missense probably benign 0.00
R5637:Olfr307 UTSW 7 86335604 missense probably benign 0.00
R6163:Olfr307 UTSW 7 86336384 missense possibly damaging 0.84
R6407:Olfr307 UTSW 7 86336069 missense possibly damaging 0.90
R7342:Olfr307 UTSW 7 86336087 missense probably benign 0.00
R8066:Olfr307 UTSW 7 86335806 missense probably benign 0.00
R8155:Olfr307 UTSW 7 86336178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCCTGAGAGCACTTTTC -3'
(R):5'- GTGGCTCCAATGTGATACCAC -3'

Sequencing Primer
(F):5'- CTGAGAGCACTTTTCACATCAG -3'
(R):5'- GTGATGTTCCCTCATTGCTAAGGATC -3'
Posted On2020-06-30