Incidental Mutation 'R8158:Tyr'
ID633366
Institutional Source Beutler Lab
Gene Symbol Tyr
Ensembl Gene ENSMUSG00000004651
Gene Nametyrosinase
SynonymsOca1, skc35
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location87424771-87493512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87472516 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 356 (D356V)
Ref Sequence ENSEMBL: ENSMUSP00000004770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004770]
Predicted Effect probably damaging
Transcript: ENSMUST00000004770
AA Change: D356V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: D356V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Tyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 0.99
Venusaur UTSW 7 87492706 missense probably damaging 1.00
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
R7007:Tyr UTSW 7 87493340 missense probably benign 0.04
R7609:Tyr UTSW 7 87483884 missense probably benign 0.06
R7767:Tyr UTSW 7 87493010 missense probably benign 0.37
R7794:Tyr UTSW 7 87483820 critical splice donor site probably null
R8383:Tyr UTSW 7 87483992 missense probably damaging 1.00
R8403:Tyr UTSW 7 87437967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACATTTGAAACACACGTTG -3'
(R):5'- TAAGAGGTCCATATTGGCCCAG -3'

Sequencing Primer
(F):5'- ACATTTGAAACACACGTTGATAATAC -3'
(R):5'- ACTGCTTAACCTATCTCACAGTG -3'
Posted On2020-06-30