Mutagenetix > Incidental Mutation

Incidental Mutation 'R8158:Sec23ip'

633368

Institutional Source

Beutler Lab

Gene Symbol

Sec23ip

Ensembl Gene

ENSMUSG00000055319

Gene Name

Sec23 interacting protein

Synonyms

D7Ertd373e, p125

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.611) question?

Stock #

R8158 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128744943-128784836 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 128767640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 696 (V696G)

Ref Sequence

ENSEMBL: ENSMUSP00000035610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042942]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000042942
AA Change: V696G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: V696G

Domain	Start	End	E-Value	Type
low complexity region	8	26	N/A	INTRINSIC
low complexity region	41	51	N/A	INTRINSIC
low complexity region	79	88	N/A	INTRINSIC
low complexity region	203	215	N/A	INTRINSIC
low complexity region	222	230	N/A	INTRINSIC
Blast:DDHD	513	585	8e-33	BLAST
SAM	637	702	2.18e-9	SMART
DDHD	777	987	1.33e-74	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,665,056	D46V	probably damaging	Het
Abl2	T	A	1: 156,642,069	S968T	probably benign	Het
Adcy8	T	C	15: 64,783,806	D608G	probably benign	Het
Adgb	C	T	10: 10,378,734	V1162M	probably benign	Het
Agrn	A	G	4: 156,173,889	V1040A	probably benign	Het
Amer3	A	T	1: 34,587,660	T327S	possibly damaging	Het
Apaf1	C	T	10: 91,059,658	C426Y	probably benign	Het
Bsn	T	C	9: 108,110,033	D2840G	unknown	Het
Camsap1	A	T	2: 25,944,428	C406*	probably null	Het
Cbr2	A	T	11: 120,730,297	M158K	probably damaging	Het
Ccdc105	G	C	10: 78,748,675	Q338E	probably benign	Het
Cgrrf1	T	C	14: 46,853,735	S239P	probably benign	Het
Clnk	C	A	5: 38,794,911		probably null	Het
Csad	T	C	15: 102,177,762	M445V	probably damaging	Het
Dnajb7	T	A	15: 81,407,399	N246Y	probably damaging	Het
Dok6	T	C	18: 89,473,947	I169V	probably benign	Het
Hist1h2bm	T	C	13: 21,722,461	Y122H	probably benign	Het
Il1f10	T	G	2: 24,291,255	I11R	possibly damaging	Het
Irs1	C	T	1: 82,289,533	V321M	probably damaging	Het
Itga9	T	C	9: 118,877,143	F938L	probably damaging	Het
Kif7	T	C	7: 79,704,694	D781G	probably damaging	Het
Klhl41	A	T	2: 69,671,161	N322I	probably damaging	Het
Krtap31-1	T	G	11: 99,908,075	C35G	possibly damaging	Het
Lsm11	A	T	11: 45,933,997	D234E	probably benign	Het
Med6	T	C	12: 81,573,903	K223R	probably benign	Het
Mfsd4b2	G	A	10: 39,922,068	T97I	probably benign	Het
Mrgpra1	A	T	7: 47,335,456	C158*	probably null	Het
Nr2e1	T	C	10: 42,582,885	T8A	probably benign	Het
Oas2	T	C	5: 120,749,773	M1V	probably null	Het
Olfr1048	T	C	2: 86,236,160	Y218C	probably damaging	Het
Olfr1132	T	A	2: 87,634,889	N286I	probably damaging	Het
Olfr307	T	A	7: 86,335,677	I240F	probably benign	Het
Olfr393	T	A	11: 73,847,871	M85L	probably benign	Het
Olfr60	T	C	7: 140,345,249	I247V	probably benign	Het
Otof	C	T	5: 30,380,194	G1257D	probably benign	Het
Phf2	T	C	13: 48,817,760	T479A	probably benign	Het
Pik3c2a	T	C	7: 116,342,997	N1516S	probably benign	Het
Qrich1	C	A	9: 108,556,037	T622K	probably damaging	Het
Rasip1	A	G	7: 45,632,519	K482R	probably damaging	Het
Rgl2	T	C	17: 33,936,944	F698L	probably benign	Het
Scarb1	T	C	5: 125,303,137	D124G	probably benign	Het
Sclt1	A	G	3: 41,671,482	I350T	probably benign	Het
Serpina1e	G	T	12: 103,951,095	T105K	probably benign	Het
Sin3a	A	G	9: 57,113,544		probably null	Het
Slc34a2	A	G	5: 53,060,840	T154A	probably damaging	Het
Slc9a3	T	C	13: 74,155,122	L178P	probably damaging	Het
Smarca2	A	C	19: 26,682,048	I913L	probably benign	Het
Tcea3	G	A	4: 136,273,716		probably null	Het
Tmcc1	T	A	6: 116,043,474	H339L		Het
Trpm2	G	T	10: 77,947,897	H247Q	probably damaging	Het
Tyr	T	A	7: 87,472,516	D356V	probably damaging	Het
Vmn2r54	A	T	7: 12,615,961	C565S	probably damaging	Het
Vmn2r82	A	C	10: 79,377,802	N74T	probably benign	Het
Zcchc4	T	C	5: 52,815,918	Y375H	probably damaging	Het
Zfhx3	T	A	8: 108,948,721	D2134E	possibly damaging	Het
Zfhx4	T	A	3: 5,398,950	Y1414*	probably null	Het
Zfp282	A	T	6: 47,890,692	E267D	possibly damaging	Het
Zfp442	A	T	2: 150,409,176	C269S	possibly damaging	Het
Zp3	T	A	5: 135,985,564	S246T	probably benign	Het

Other mutations in Sec23ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Sec23ip	APN	7	128767609	missense	probably damaging	1.00
IGL01347:Sec23ip	APN	7	128762405	missense	probably benign	0.08
IGL01358:Sec23ip	APN	7	128752797	missense	possibly damaging	0.68
IGL01656:Sec23ip	APN	7	128750245	missense	probably damaging	1.00
IGL01835:Sec23ip	APN	7	128755311	splice site	probably null
IGL02233:Sec23ip	APN	7	128779179	missense	probably damaging	1.00
IGL02499:Sec23ip	APN	7	128776916	missense	probably damaging	1.00
IGL03381:Sec23ip	APN	7	128750305	missense	probably damaging	0.97
R0053:Sec23ip	UTSW	7	128745167	missense	probably damaging	1.00
R0147:Sec23ip	UTSW	7	128779051	splice site	probably benign
R0360:Sec23ip	UTSW	7	128761405	splice site	probably benign
R1427:Sec23ip	UTSW	7	128776885	missense	probably damaging	0.99
R1442:Sec23ip	UTSW	7	128776786	missense	probably benign	0.10
R1462:Sec23ip	UTSW	7	128766138	missense	probably benign
R1462:Sec23ip	UTSW	7	128766138	missense	probably benign
R1564:Sec23ip	UTSW	7	128766281	splice site	probably null
R1876:Sec23ip	UTSW	7	128752851	missense	probably benign
R1966:Sec23ip	UTSW	7	128755353	missense	probably damaging	0.98
R1977:Sec23ip	UTSW	7	128766273	missense	probably damaging	1.00
R2115:Sec23ip	UTSW	7	128762461	missense	probably benign	0.00
R2847:Sec23ip	UTSW	7	128754073	missense	probably benign	0.00
R3958:Sec23ip	UTSW	7	128776850	missense	probably benign	0.35
R3959:Sec23ip	UTSW	7	128776850	missense	probably benign	0.35
R3960:Sec23ip	UTSW	7	128776850	missense	probably benign	0.35
R4287:Sec23ip	UTSW	7	128777333	missense	probably benign	0.37
R4510:Sec23ip	UTSW	7	128779176	missense	probably damaging	1.00
R4511:Sec23ip	UTSW	7	128779176	missense	probably damaging	1.00
R4612:Sec23ip	UTSW	7	128750502	nonsense	probably null
R4660:Sec23ip	UTSW	7	128750286	missense	probably null	0.00
R4890:Sec23ip	UTSW	7	128752910	missense	probably damaging	0.98
R5287:Sec23ip	UTSW	7	128766136	missense	probably benign
R5587:Sec23ip	UTSW	7	128750427	missense	probably benign
R5625:Sec23ip	UTSW	7	128744983	unclassified	probably benign
R5656:Sec23ip	UTSW	7	128776784	missense	probably damaging	1.00
R5808:Sec23ip	UTSW	7	128772184	missense	probably benign	0.00
R6034:Sec23ip	UTSW	7	128750203	missense	possibly damaging	0.66
R6034:Sec23ip	UTSW	7	128750203	missense	possibly damaging	0.66
R6145:Sec23ip	UTSW	7	128778484	missense	probably damaging	0.99
R6747:Sec23ip	UTSW	7	128752849	synonymous	silent
R6953:Sec23ip	UTSW	7	128752796	nonsense	probably null
R6992:Sec23ip	UTSW	7	128765440	missense	probably benign
R7131:Sec23ip	UTSW	7	128779640	missense	probably damaging	1.00
R7163:Sec23ip	UTSW	7	128762533	critical splice donor site	probably null
R7387:Sec23ip	UTSW	7	128745003	unclassified	probably benign
R7559:Sec23ip	UTSW	7	128777350	missense	possibly damaging	0.65
R7975:Sec23ip	UTSW	7	128762477	missense	probably damaging	1.00
R8337:Sec23ip	UTSW	7	128764025	missense	probably damaging	1.00
R8409:Sec23ip	UTSW	7	128764131	missense	probably damaging	1.00
R8418:Sec23ip	UTSW	7	128778463	missense	probably damaging	0.98
R8434:Sec23ip	UTSW	7	128750427	missense	probably benign
R8461:Sec23ip	UTSW	7	128772202	missense	probably benign
R8553:Sec23ip	UTSW	7	128754053	missense	probably damaging	1.00
R8897:Sec23ip	UTSW	7	128752743	missense	probably benign	0.14
R9059:Sec23ip	UTSW	7	128764081	missense	probably damaging	1.00
R9142:Sec23ip	UTSW	7	128761502	missense	probably damaging	1.00
R9674:Sec23ip	UTSW	7	128778463	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCCAAGCTTCTTGCAGTTG -3'
(R):5'- ACCAAACGGTATTGCAAGCTTC -3'

Sequencing Primer
(F):5'- CCCACTTTGAGCTCATCA -3'
(R):5'- CCTGTAATTCCAAGAGGCTCAGG -3'

Posted On

2020-06-30