Mutagenetix > Incidental Mutations

Incidental Mutation 'R8158:Sin3a'

633372

Institutional Source

Beutler Lab

Gene Symbol

Sin3a

Ensembl Gene

ENSMUSG00000042557

Gene Name

transcriptional regulator, SIN3A (yeast)

Synonyms

Sin3, mSin3A

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8158 (G1)

Quality Score

179.009

Status

Not validated

Chromosome

Chromosomal Location

57072040-57128366 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 57113544 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]

Predicted Effect

probably null
Transcript: ENSMUST00000049169

SMART Domains

Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000167715

SMART Domains

Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168177

SMART Domains

Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	142	186	5.3e-22	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	323	380	9.6e-22	PFAM
Pfam:PAH	479	523	8.1e-11	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
Pfam:Sin3a_C	887	1190	1.2e-93	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168502

SMART Domains

Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1138	1154	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168678

SMART Domains

Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,665,056	D46V	probably damaging	Het
Abl2	T	A	1: 156,642,069	S968T	probably benign	Het
Adcy8	T	C	15: 64,783,806	D608G	probably benign	Het
Adgb	C	T	10: 10,378,734	V1162M	probably benign	Het
Agrn	A	G	4: 156,173,889	V1040A	probably benign	Het
Amer3	A	T	1: 34,587,660	T327S	possibly damaging	Het
Apaf1	C	T	10: 91,059,658	C426Y	probably benign	Het
Bsn	T	C	9: 108,110,033	D2840G	unknown	Het
Camsap1	A	T	2: 25,944,428	C406*	probably null	Het
Cbr2	A	T	11: 120,730,297	M158K	probably damaging	Het
Ccdc105	G	C	10: 78,748,675	Q338E	probably benign	Het
Cgrrf1	T	C	14: 46,853,735	S239P	probably benign	Het
Clnk	C	A	5: 38,794,911		probably null	Het
Csad	T	C	15: 102,177,762	M445V	probably damaging	Het
Dnajb7	T	A	15: 81,407,399	N246Y	probably damaging	Het
Dok6	T	C	18: 89,473,947	I169V	probably benign	Het
Hist1h2bm	T	C	13: 21,722,461	Y122H	probably benign	Het
Il1f10	T	G	2: 24,291,255	I11R	possibly damaging	Het
Irs1	C	T	1: 82,289,533	V321M	probably damaging	Het
Itga9	T	C	9: 118,877,143	F938L	probably damaging	Het
Kif7	T	C	7: 79,704,694	D781G	probably damaging	Het
Klhl41	A	T	2: 69,671,161	N322I	probably damaging	Het
Krtap31-1	T	G	11: 99,908,075	C35G	possibly damaging	Het
Lsm11	A	T	11: 45,933,997	D234E	probably benign	Het
Med6	T	C	12: 81,573,903	K223R	probably benign	Het
Mfsd4b2	G	A	10: 39,922,068	T97I	probably benign	Het
Mrgpra1	A	T	7: 47,335,456	C158*	probably null	Het
Nr2e1	T	C	10: 42,582,885	T8A	probably benign	Het
Oas2	T	C	5: 120,749,773	M1V	probably null	Het
Olfr1048	T	C	2: 86,236,160	Y218C	probably damaging	Het
Olfr1132	T	A	2: 87,634,889	N286I	probably damaging	Het
Olfr307	T	A	7: 86,335,677	I240F	probably benign	Het
Olfr393	T	A	11: 73,847,871	M85L	probably benign	Het
Olfr60	T	C	7: 140,345,249	I247V	probably benign	Het
Otof	C	T	5: 30,380,194	G1257D	probably benign	Het
Phf2	T	C	13: 48,817,760	T479A	probably benign	Het
Pik3c2a	T	C	7: 116,342,997	N1516S	probably benign	Het
Qrich1	C	A	9: 108,556,037	T622K	probably damaging	Het
Rasip1	A	G	7: 45,632,519	K482R	probably damaging	Het
Rgl2	T	C	17: 33,936,944	F698L	probably benign	Het
Scarb1	T	C	5: 125,303,137	D124G	probably benign	Het
Sclt1	A	G	3: 41,671,482	I350T	probably benign	Het
Sec23ip	T	G	7: 128,767,640	V696G	probably damaging	Het
Serpina1e	G	T	12: 103,951,095	T105K	probably benign	Het
Slc34a2	A	G	5: 53,060,840	T154A	probably damaging	Het
Slc9a3	T	C	13: 74,155,122	L178P	probably damaging	Het
Smarca2	A	C	19: 26,682,048	I913L	probably benign	Het
Tcea3	G	A	4: 136,273,716		probably null	Het
Tmcc1	T	A	6: 116,043,474	H339L		Het
Trpm2	G	T	10: 77,947,897	H247Q	probably damaging	Het
Tyr	T	A	7: 87,472,516	D356V	probably damaging	Het
Vmn2r54	A	T	7: 12,615,961	C565S	probably damaging	Het
Vmn2r82	A	C	10: 79,377,802	N74T	probably benign	Het
Zcchc4	T	C	5: 52,815,918	Y375H	probably damaging	Het
Zfhx3	T	A	8: 108,948,721	D2134E	possibly damaging	Het
Zfhx4	T	A	3: 5,398,950	Y1414*	probably null	Het
Zfp282	A	T	6: 47,890,692	E267D	possibly damaging	Het
Zfp442	A	T	2: 150,409,176	C269S	possibly damaging	Het
Zp3	T	A	5: 135,985,564	S246T	probably benign	Het

Other mutations in Sin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Sin3a	APN	9	57097901	missense	probably damaging	1.00
IGL00836:Sin3a	APN	9	57107345	splice site	probably null
IGL00913:Sin3a	APN	9	57098118	missense	probably benign	0.01
IGL01721:Sin3a	APN	9	57095325	missense	probably damaging	1.00
IGL01964:Sin3a	APN	9	57107347	splice site	probably benign
IGL02333:Sin3a	APN	9	57107559	missense	possibly damaging	0.86
IGL02673:Sin3a	APN	9	57107441	missense	probably damaging	0.99
Delicate	UTSW	9	57103929	missense	probably damaging	1.00
IGL03014:Sin3a	UTSW	9	57095255	intron	probably benign
PIT4519001:Sin3a	UTSW	9	57095456	missense	possibly damaging	0.86
R0024:Sin3a	UTSW	9	57118253	intron	probably benign
R0309:Sin3a	UTSW	9	57110912	missense	probably benign	0.00
R0511:Sin3a	UTSW	9	57096895	nonsense	probably null
R1205:Sin3a	UTSW	9	57119175	missense	probably damaging	1.00
R1365:Sin3a	UTSW	9	57125203	nonsense	probably null
R1496:Sin3a	UTSW	9	57119158	missense	possibly damaging	0.77
R1544:Sin3a	UTSW	9	57103997	splice site	probably benign
R1958:Sin3a	UTSW	9	57105609	missense	probably damaging	1.00
R1993:Sin3a	UTSW	9	57101199	missense	probably damaging	1.00
R2037:Sin3a	UTSW	9	57096825	missense	probably benign	0.14
R2065:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R2079:Sin3a	UTSW	9	57089523	missense	probably benign
R2193:Sin3a	UTSW	9	57117477	missense	possibly damaging	0.93
R3004:Sin3a	UTSW	9	57096834	nonsense	probably null
R3929:Sin3a	UTSW	9	57118137	missense	probably damaging	0.98
R4326:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4327:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4329:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4765:Sin3a	UTSW	9	57096803	missense	probably benign	0.14
R4806:Sin3a	UTSW	9	57086742	missense	probably damaging	0.99
R4979:Sin3a	UTSW	9	57118076	missense	probably damaging	1.00
R5018:Sin3a	UTSW	9	57110891	missense	probably benign	0.00
R5368:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R5379:Sin3a	UTSW	9	57110988	missense	probably benign	0.10
R5391:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5395:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5519:Sin3a	UTSW	9	57118173	critical splice donor site	probably null
R5927:Sin3a	UTSW	9	57111111	missense	probably damaging	1.00
R5987:Sin3a	UTSW	9	57127200	missense	possibly damaging	0.75
R6083:Sin3a	UTSW	9	57107540	missense	probably damaging	1.00
R6161:Sin3a	UTSW	9	57095424	missense	possibly damaging	0.48
R6196:Sin3a	UTSW	9	57103929	missense	probably damaging	1.00
R6374:Sin3a	UTSW	9	57117481	missense	probably benign
R6456:Sin3a	UTSW	9	57113701	missense	possibly damaging	0.79
R6815:Sin3a	UTSW	9	57117540	missense	probably benign	0.02
R6900:Sin3a	UTSW	9	57107574	missense	probably damaging	1.00
R7051:Sin3a	UTSW	9	57103934	missense	probably damaging	1.00
R7081:Sin3a	UTSW	9	57094471	missense	probably null	1.00
R7285:Sin3a	UTSW	9	57127299	missense	possibly damaging	0.57
R7462:Sin3a	UTSW	9	57095525	missense	probably benign	0.00
R7538:Sin3a	UTSW	9	57103926	missense	possibly damaging	0.95
R7699:Sin3a	UTSW	9	57110654	nonsense	probably null
R8150:Sin3a	UTSW	9	57127284	missense	possibly damaging	0.92
RF017:Sin3a	UTSW	9	57127326	missense	possibly damaging	0.90
X0026:Sin3a	UTSW	9	57125192	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GACAGTTCTGGTGATTATAGCTGC -3'
(R):5'- AACACCTTCCCTTGGTAGCG -3'

Sequencing Primer
(F):5'- ATAGCTGCCTACTAGATGTCATC -3'
(R):5'- TTGGTAGCGCTAACCTCCAAC -3'

Posted On

2020-06-30