Incidental Mutation 'R8158:Nr2e1'
ID633378
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Namenuclear receptor subfamily 2, group E, member 1
SynonymsMtll, Tlx, tailless, Nr2e1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R8158 (G1)
Quality Score162.009
Status Not validated
Chromosome10
Chromosomal Location42561963-42583632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42582885 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105497] [ENSMUST00000144806]
Predicted Effect probably benign
Transcript: ENSMUST00000019938
AA Change: T8A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: T8A

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105497
SMART Domains Protein: ENSMUSP00000101136
Gene: ENSMUSG00000038280

DomainStartEndE-ValueType
Pfam:OSTMP1 1 171 1.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144806
SMART Domains Protein: ENSMUSP00000116534
Gene: ENSMUSG00000038280

DomainStartEndE-ValueType
Pfam:OSTMP1 1 169 4.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42568453 missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42567973 missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42567979 missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42571482 missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42568381 missense probably damaging 1.00
Dubious UTSW 10 42571487 nonsense probably null
BB010:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42567968 missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42582909 unclassified probably null
R1879:Nr2e1 UTSW 10 42568371 critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42572778 missense probably benign
R2426:Nr2e1 UTSW 10 42563485 missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42568445 missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42578191 missense probably benign
R5305:Nr2e1 UTSW 10 42571487 nonsense probably null
R5316:Nr2e1 UTSW 10 42571491 missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42572784 missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42572769 missense probably benign
R7040:Nr2e1 UTSW 10 42568378 missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42563479 missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42574437 missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R8342:Nr2e1 UTSW 10 42568429 missense probably damaging 1.00
Z1177:Nr2e1 UTSW 10 42568427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTCTCCCAGTTGCACG -3'
(R):5'- TGTGGAACGAATTCTGAGCG -3'

Sequencing Primer
(F):5'- GTTGCACGAAACGCTCC -3'
(R):5'- AATTCTGAGCGCCGGGGAG -3'
Posted On2020-06-30