Incidental Mutation 'R8158:Nr2e1'
ID 633378
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Name nuclear receptor subfamily 2, group E, member 1
Synonyms tailless, Mtll, Tlx, Nr2e1
MMRRC Submission 067584-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.895) question?
Stock # R8158 (G1)
Quality Score 162.009
Status Not validated
Chromosome 10
Chromosomal Location 42437959-42459628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42458881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105497] [ENSMUST00000144806]
AlphaFold Q64104
Predicted Effect probably benign
Transcript: ENSMUST00000019938
AA Change: T8A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: T8A

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105497
SMART Domains Protein: ENSMUSP00000101136
Gene: ENSMUSG00000038280

DomainStartEndE-ValueType
Pfam:OSTMP1 1 171 1.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144806
SMART Domains Protein: ENSMUSP00000116534
Gene: ENSMUSG00000038280

DomainStartEndE-ValueType
Pfam:OSTMP1 1 169 4.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,469,639 (GRCm39) S968T probably benign Het
Adcy8 T C 15: 64,655,655 (GRCm39) D608G probably benign Het
Adgb C T 10: 10,254,478 (GRCm39) V1162M probably benign Het
Agrn A G 4: 156,258,346 (GRCm39) V1040A probably benign Het
Amer3 A T 1: 34,626,741 (GRCm39) T327S possibly damaging Het
Apaf1 C T 10: 90,895,520 (GRCm39) C426Y probably benign Het
Bsn T C 9: 107,987,232 (GRCm39) D2840G unknown Het
Camsap1 A T 2: 25,834,440 (GRCm39) C406* probably null Het
Cbr2 A T 11: 120,621,123 (GRCm39) M158K probably damaging Het
Cgrrf1 T C 14: 47,091,192 (GRCm39) S239P probably benign Het
Clnk C A 5: 38,952,254 (GRCm39) probably null Het
Csad T C 15: 102,086,197 (GRCm39) M445V probably damaging Het
Dnajb7 T A 15: 81,291,600 (GRCm39) N246Y probably damaging Het
Dok6 T C 18: 89,492,071 (GRCm39) I169V probably benign Het
H2bc14 T C 13: 21,906,631 (GRCm39) Y122H probably benign Het
Il1f10 T G 2: 24,181,267 (GRCm39) I11R possibly damaging Het
Irs1 C T 1: 82,267,254 (GRCm39) V321M probably damaging Het
Itga9 T C 9: 118,706,211 (GRCm39) F938L probably damaging Het
Kif7 T C 7: 79,354,442 (GRCm39) D781G probably damaging Het
Klhl41 A T 2: 69,501,505 (GRCm39) N322I probably damaging Het
Krtap31-1 T G 11: 99,798,901 (GRCm39) C35G possibly damaging Het
Lsm11 A T 11: 45,824,824 (GRCm39) D234E probably benign Het
Med6 T C 12: 81,620,677 (GRCm39) K223R probably benign Het
Mfsd4b2 G A 10: 39,798,064 (GRCm39) T97I probably benign Het
Mrgpra1 A T 7: 46,985,204 (GRCm39) C158* probably null Het
Oas2 T C 5: 120,887,838 (GRCm39) M1V probably null Het
Or13a27 T C 7: 139,925,162 (GRCm39) I247V probably benign Het
Or14a260 T A 7: 85,984,885 (GRCm39) I240F probably benign Het
Or1e33 T A 11: 73,738,697 (GRCm39) M85L probably benign Het
Or8k17 T C 2: 86,066,504 (GRCm39) Y218C probably damaging Het
Or8w1 T A 2: 87,465,233 (GRCm39) N286I probably damaging Het
Otof C T 5: 30,537,538 (GRCm39) G1257D probably benign Het
Phf2 T C 13: 48,971,236 (GRCm39) T479A probably benign Het
Pik3c2a T C 7: 115,942,232 (GRCm39) N1516S probably benign Het
Qrich1 C A 9: 108,433,236 (GRCm39) T622K probably damaging Het
Rasip1 A G 7: 45,281,943 (GRCm39) K482R probably damaging Het
Rgl2 T C 17: 34,155,918 (GRCm39) F698L probably benign Het
Scarb1 T C 5: 125,380,201 (GRCm39) D124G probably benign Het
Sclt1 A G 3: 41,625,917 (GRCm39) I350T probably benign Het
Sec23ip T G 7: 128,369,364 (GRCm39) V696G probably damaging Het
Serpina1e G T 12: 103,917,354 (GRCm39) T105K probably benign Het
Sin3a A G 9: 57,020,828 (GRCm39) probably null Het
Slc34a2 A G 5: 53,218,182 (GRCm39) T154A probably damaging Het
Slc9a3 T C 13: 74,303,241 (GRCm39) L178P probably damaging Het
Smarca2 A C 19: 26,659,448 (GRCm39) I913L probably benign Het
Spaca7b T A 8: 11,715,056 (GRCm39) D46V probably damaging Het
Tcea3 G A 4: 136,001,027 (GRCm39) probably null Het
Tektl1 G C 10: 78,584,509 (GRCm39) Q338E probably benign Het
Tmcc1 T A 6: 116,020,435 (GRCm39) H339L Het
Trpm2 G T 10: 77,783,731 (GRCm39) H247Q probably damaging Het
Tyr T A 7: 87,121,724 (GRCm39) D356V probably damaging Het
Vmn2r54 A T 7: 12,349,888 (GRCm39) C565S probably damaging Het
Vmn2r82 A C 10: 79,213,636 (GRCm39) N74T probably benign Het
Zcchc4 T C 5: 52,973,260 (GRCm39) Y375H probably damaging Het
Zfhx3 T A 8: 109,675,353 (GRCm39) D2134E possibly damaging Het
Zfhx4 T A 3: 5,464,010 (GRCm39) Y1414* probably null Het
Zfp282 A T 6: 47,867,626 (GRCm39) E267D possibly damaging Het
Zfp442 A T 2: 150,251,096 (GRCm39) C269S possibly damaging Het
Zp3 T A 5: 136,014,418 (GRCm39) S246T probably benign Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42,444,449 (GRCm39) missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42,443,969 (GRCm39) missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42,443,975 (GRCm39) missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42,447,478 (GRCm39) missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42,444,377 (GRCm39) missense probably damaging 1.00
Dubious UTSW 10 42,447,483 (GRCm39) nonsense probably null
BB010:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42,443,964 (GRCm39) missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42,458,905 (GRCm39) splice site probably null
R1879:Nr2e1 UTSW 10 42,444,367 (GRCm39) critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42,448,774 (GRCm39) missense probably benign
R2426:Nr2e1 UTSW 10 42,439,481 (GRCm39) missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42,444,441 (GRCm39) missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42,454,187 (GRCm39) missense probably benign
R5305:Nr2e1 UTSW 10 42,447,483 (GRCm39) nonsense probably null
R5316:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42,448,780 (GRCm39) missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42,448,765 (GRCm39) missense probably benign
R7040:Nr2e1 UTSW 10 42,444,374 (GRCm39) missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42,439,475 (GRCm39) missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42,450,433 (GRCm39) missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R8342:Nr2e1 UTSW 10 42,444,425 (GRCm39) missense probably damaging 1.00
R8916:Nr2e1 UTSW 10 42,443,864 (GRCm39) missense possibly damaging 0.94
R9145:Nr2e1 UTSW 10 42,448,948 (GRCm39) missense probably benign 0.02
R9189:Nr2e1 UTSW 10 42,454,268 (GRCm39) missense probably damaging 0.99
R9381:Nr2e1 UTSW 10 42,439,468 (GRCm39) missense probably damaging 1.00
R9499:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R9552:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
Z1177:Nr2e1 UTSW 10 42,444,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTCTCCCAGTTGCACG -3'
(R):5'- TGTGGAACGAATTCTGAGCG -3'

Sequencing Primer
(F):5'- GTTGCACGAAACGCTCC -3'
(R):5'- AATTCTGAGCGCCGGGGAG -3'
Posted On 2020-06-30