Incidental Mutation 'R8158:Vmn2r82'
ID633381
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Namevomeronasal 2, receptor 82
SynonymsEG624845
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79356576-79397198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 79377802 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 74 (N74T)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
Predicted Effect probably benign
Transcript: ENSMUST00000170596
AA Change: N74T

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: N74T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79356747 missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79378857 missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79378072 missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79378711 missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79379223 missense probably benign
IGL02112:Vmn2r82 APN 10 79395999 missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79356708 missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79379371 missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79377844 missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79381315 missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79356809 splice site probably null
IGL03349:Vmn2r82 APN 10 79377869 missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79396626 missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79396505 missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79381295 missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79378800 missense possibly damaging 0.46
R0285:Vmn2r82 UTSW 10 79396557 missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79377905 nonsense probably null
R1385:Vmn2r82 UTSW 10 79396491 nonsense probably null
R1386:Vmn2r82 UTSW 10 79378711 missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79379367 missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79378868 missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79356744 missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79379419 missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79379212 missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79396510 missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79396056 missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79378846 missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79395979 missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79356685 missense probably benign
R2442:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79377868 missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79396080 missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79379040 missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79356714 missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79378807 missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79378755 missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79379176 missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79396087 missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79356657 missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79396191 missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79378818 missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79395893 missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79379037 missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79378771 missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79379434 missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79396618 missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79356630 missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79396617 missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79396442 nonsense probably null
R7430:Vmn2r82 UTSW 10 79381253 missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79396008 missense possibly damaging 0.82
R7874:Vmn2r82 UTSW 10 79396511 missense probably damaging 1.00
R7943:Vmn2r82 UTSW 10 79396245 missense possibly damaging 0.74
R8324:Vmn2r82 UTSW 10 79378893 nonsense probably null
R8340:Vmn2r82 UTSW 10 79381202 missense probably benign 0.00
Z1088:Vmn2r82 UTSW 10 79356622 missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79356595 missense probably benign 0.03
Z1177:Vmn2r82 UTSW 10 79396535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCTATAATTAACAAGGTCCCC -3'
(R):5'- GTAAGTGTAGCAGCTGATTTGC -3'

Sequencing Primer
(F):5'- AGGTCCCCCTTTCAGGATC -3'
(R):5'- TAATTAGGGATCACACTACTCAAACC -3'
Posted On2020-06-30