Incidental Mutation 'R8158:Krtap31-1'
ID 633385
Institutional Source Beutler Lab
Gene Symbol Krtap31-1
Ensembl Gene ENSMUSG00000070334
Gene Name keratin associated protein 31-1
Synonyms 4733401H21Rik
MMRRC Submission 067584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R8158 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 99798746-99799716 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 99798901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 35 (C35G)
Ref Sequence ENSEMBL: ENSMUSP00000091467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093935]
AlphaFold Q9D644
Predicted Effect possibly damaging
Transcript: ENSMUST00000093935
AA Change: C35G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091467
Gene: ENSMUSG00000070334
AA Change: C35G

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 40 56 N/A INTRINSIC
Pfam:Keratin_B2_2 64 107 1.9e-9 PFAM
Pfam:Keratin_B2_2 111 157 2.4e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,469,639 (GRCm39) S968T probably benign Het
Adcy8 T C 15: 64,655,655 (GRCm39) D608G probably benign Het
Adgb C T 10: 10,254,478 (GRCm39) V1162M probably benign Het
Agrn A G 4: 156,258,346 (GRCm39) V1040A probably benign Het
Amer3 A T 1: 34,626,741 (GRCm39) T327S possibly damaging Het
Apaf1 C T 10: 90,895,520 (GRCm39) C426Y probably benign Het
Bsn T C 9: 107,987,232 (GRCm39) D2840G unknown Het
Camsap1 A T 2: 25,834,440 (GRCm39) C406* probably null Het
Cbr2 A T 11: 120,621,123 (GRCm39) M158K probably damaging Het
Cgrrf1 T C 14: 47,091,192 (GRCm39) S239P probably benign Het
Clnk C A 5: 38,952,254 (GRCm39) probably null Het
Csad T C 15: 102,086,197 (GRCm39) M445V probably damaging Het
Dnajb7 T A 15: 81,291,600 (GRCm39) N246Y probably damaging Het
Dok6 T C 18: 89,492,071 (GRCm39) I169V probably benign Het
H2bc14 T C 13: 21,906,631 (GRCm39) Y122H probably benign Het
Il1f10 T G 2: 24,181,267 (GRCm39) I11R possibly damaging Het
Irs1 C T 1: 82,267,254 (GRCm39) V321M probably damaging Het
Itga9 T C 9: 118,706,211 (GRCm39) F938L probably damaging Het
Kif7 T C 7: 79,354,442 (GRCm39) D781G probably damaging Het
Klhl41 A T 2: 69,501,505 (GRCm39) N322I probably damaging Het
Lsm11 A T 11: 45,824,824 (GRCm39) D234E probably benign Het
Med6 T C 12: 81,620,677 (GRCm39) K223R probably benign Het
Mfsd4b2 G A 10: 39,798,064 (GRCm39) T97I probably benign Het
Mrgpra1 A T 7: 46,985,204 (GRCm39) C158* probably null Het
Nr2e1 T C 10: 42,458,881 (GRCm39) T8A probably benign Het
Oas2 T C 5: 120,887,838 (GRCm39) M1V probably null Het
Or13a27 T C 7: 139,925,162 (GRCm39) I247V probably benign Het
Or14a260 T A 7: 85,984,885 (GRCm39) I240F probably benign Het
Or1e33 T A 11: 73,738,697 (GRCm39) M85L probably benign Het
Or8k17 T C 2: 86,066,504 (GRCm39) Y218C probably damaging Het
Or8w1 T A 2: 87,465,233 (GRCm39) N286I probably damaging Het
Otof C T 5: 30,537,538 (GRCm39) G1257D probably benign Het
Phf2 T C 13: 48,971,236 (GRCm39) T479A probably benign Het
Pik3c2a T C 7: 115,942,232 (GRCm39) N1516S probably benign Het
Qrich1 C A 9: 108,433,236 (GRCm39) T622K probably damaging Het
Rasip1 A G 7: 45,281,943 (GRCm39) K482R probably damaging Het
Rgl2 T C 17: 34,155,918 (GRCm39) F698L probably benign Het
Scarb1 T C 5: 125,380,201 (GRCm39) D124G probably benign Het
Sclt1 A G 3: 41,625,917 (GRCm39) I350T probably benign Het
Sec23ip T G 7: 128,369,364 (GRCm39) V696G probably damaging Het
Serpina1e G T 12: 103,917,354 (GRCm39) T105K probably benign Het
Sin3a A G 9: 57,020,828 (GRCm39) probably null Het
Slc34a2 A G 5: 53,218,182 (GRCm39) T154A probably damaging Het
Slc9a3 T C 13: 74,303,241 (GRCm39) L178P probably damaging Het
Smarca2 A C 19: 26,659,448 (GRCm39) I913L probably benign Het
Spaca7b T A 8: 11,715,056 (GRCm39) D46V probably damaging Het
Tcea3 G A 4: 136,001,027 (GRCm39) probably null Het
Tektl1 G C 10: 78,584,509 (GRCm39) Q338E probably benign Het
Tmcc1 T A 6: 116,020,435 (GRCm39) H339L Het
Trpm2 G T 10: 77,783,731 (GRCm39) H247Q probably damaging Het
Tyr T A 7: 87,121,724 (GRCm39) D356V probably damaging Het
Vmn2r54 A T 7: 12,349,888 (GRCm39) C565S probably damaging Het
Vmn2r82 A C 10: 79,213,636 (GRCm39) N74T probably benign Het
Zcchc4 T C 5: 52,973,260 (GRCm39) Y375H probably damaging Het
Zfhx3 T A 8: 109,675,353 (GRCm39) D2134E possibly damaging Het
Zfhx4 T A 3: 5,464,010 (GRCm39) Y1414* probably null Het
Zfp282 A T 6: 47,867,626 (GRCm39) E267D possibly damaging Het
Zfp442 A T 2: 150,251,096 (GRCm39) C269S possibly damaging Het
Zp3 T A 5: 136,014,418 (GRCm39) S246T probably benign Het
Other mutations in Krtap31-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1608:Krtap31-1 UTSW 11 99,798,919 (GRCm39) missense probably benign 0.18
R2284:Krtap31-1 UTSW 11 99,799,081 (GRCm39) nonsense probably null
R2343:Krtap31-1 UTSW 11 99,798,847 (GRCm39) missense possibly damaging 0.86
R4072:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4074:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4076:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4086:Krtap31-1 UTSW 11 99,799,145 (GRCm39) missense possibly damaging 0.93
R4884:Krtap31-1 UTSW 11 99,799,310 (GRCm39) missense unknown
R7644:Krtap31-1 UTSW 11 99,799,048 (GRCm39) missense possibly damaging 0.71
R7670:Krtap31-1 UTSW 11 99,799,258 (GRCm39) missense not run
R7897:Krtap31-1 UTSW 11 99,798,949 (GRCm39) missense possibly damaging 0.73
R7949:Krtap31-1 UTSW 11 99,799,144 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTGACTGGAAGAACTTGCTACATTG -3'
(R):5'- CAAGTTGGTTGGCAGCAGAG -3'

Sequencing Primer
(F):5'- GCTACATTGTGTAAAACTCATCTGGG -3'
(R):5'- GCTGGCAGCAAGGTGTG -3'
Posted On 2020-06-30