Incidental Mutation 'R8158:Phf2'
ID633390
Institutional Source Beutler Lab
Gene Symbol Phf2
Ensembl Gene ENSMUSG00000038025
Gene NamePHD finger protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R8158 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location48801750-48871119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48817760 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 479 (T479A)
Ref Sequence ENSEMBL: ENSMUSP00000047308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035540]
Predicted Effect probably benign
Transcript: ENSMUST00000035540
AA Change: T479A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047308
Gene: ENSMUSG00000038025
AA Change: T479A

DomainStartEndE-ValueType
PHD 7 54 1.08e-9 SMART
JmjC 197 353 1.98e-47 SMART
low complexity region 468 481 N/A INTRINSIC
low complexity region 487 532 N/A INTRINSIC
low complexity region 884 891 N/A INTRINSIC
coiled coil region 924 948 N/A INTRINSIC
low complexity region 953 1021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a zinc finger-like PHD (plant homeodomain) finger, distinct from other classes of zinc finger motifs, and a hydrophobic and highly conserved domain. The PHD finger shows the typical Cys4-His-Cys3 arrangement. PHD finger genes are thought to belong to a diverse group of transcriptional regulators possibly affecting eukaryotic gene expression by influencing chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body weight, decreased adipocity and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zcchc4 T C 5: 52,815,918 Y375H probably damaging Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Phf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Phf2 APN 13 48819607 missense unknown
IGL01554:Phf2 APN 13 48805879 nonsense probably null
IGL02063:Phf2 APN 13 48821642 missense unknown
IGL02456:Phf2 APN 13 48828846 missense unknown
IGL02498:Phf2 APN 13 48805239 missense unknown
IGL02586:Phf2 APN 13 48813858 splice site probably benign
IGL02688:Phf2 APN 13 48805839 missense unknown
H8441:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
R0265:Phf2 UTSW 13 48828794 missense unknown
R0389:Phf2 UTSW 13 48804489 missense unknown
R0535:Phf2 UTSW 13 48813947 missense unknown
R1162:Phf2 UTSW 13 48819641 splice site probably benign
R1342:Phf2 UTSW 13 48804477 missense unknown
R1551:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R1551:Phf2 UTSW 13 48832103 missense unknown
R1567:Phf2 UTSW 13 48832113 missense unknown
R1698:Phf2 UTSW 13 48807630 missense unknown
R1766:Phf2 UTSW 13 48819557 missense unknown
R1785:Phf2 UTSW 13 48817567 missense unknown
R1997:Phf2 UTSW 13 48828908 missense unknown
R2034:Phf2 UTSW 13 48817730 missense unknown
R2096:Phf2 UTSW 13 48832113 nonsense probably null
R2147:Phf2 UTSW 13 48804689 missense unknown
R2149:Phf2 UTSW 13 48804689 missense unknown
R2154:Phf2 UTSW 13 48820073 missense unknown
R2296:Phf2 UTSW 13 48835278 missense unknown
R4212:Phf2 UTSW 13 48820613 missense unknown
R4749:Phf2 UTSW 13 48821709 splice site probably null
R4770:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R4948:Phf2 UTSW 13 48807722 missense unknown
R4989:Phf2 UTSW 13 48807844 missense unknown
R5792:Phf2 UTSW 13 48820042 splice site probably null
R5848:Phf2 UTSW 13 48820070 missense unknown
R6092:Phf2 UTSW 13 48816057 missense unknown
R6165:Phf2 UTSW 13 48813865 critical splice donor site probably null
R6192:Phf2 UTSW 13 48820107 missense unknown
R6237:Phf2 UTSW 13 48803655 nonsense probably null
R6249:Phf2 UTSW 13 48805872 missense unknown
R6489:Phf2 UTSW 13 48826182 missense unknown
R7616:Phf2 UTSW 13 48807607 missense unknown
R8058:Phf2 UTSW 13 48823082 missense unknown
R8186:Phf2 UTSW 13 48807751 missense unknown
R8218:Phf2 UTSW 13 48804628 missense unknown
R8237:Phf2 UTSW 13 48823038 missense unknown
R8431:Phf2 UTSW 13 48821602 missense unknown
V1024:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
X0027:Phf2 UTSW 13 48832118 missense unknown
Z1176:Phf2 UTSW 13 48807707 missense unknown
Z1177:Phf2 UTSW 13 48804593 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCTGACTCCTTGCACTTC -3'
(R):5'- ACTATGAACATGTCACATGGTGTC -3'

Sequencing Primer
(F):5'- GACTCCTTGCACTTCTTCCC -3'
(R):5'- AACATGTCACATGGTGTCAGCTG -3'
Posted On2020-06-30