Incidental Mutation 'R7905:Ldhc'
ID633409
Institutional Source Beutler Lab
Gene Symbol Ldhc
Ensembl Gene ENSMUSG00000030851
Gene Namelactate dehydrogenase C
SynonymsLdh3, Ldh-3, Ldhc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7905 (G1)
Quality Score194.009
Status Validated
Chromosome7
Chromosomal Location46861203-46878142 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 46875531 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014545] [ENSMUST00000126004] [ENSMUST00000148565] [ENSMUST00000210585] [ENSMUST00000211784]
Predicted Effect probably benign
Transcript: ENSMUST00000014545
SMART Domains Protein: ENSMUSP00000014545
Gene: ENSMUSG00000030851

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 7.6e-48 PFAM
Pfam:Ldh_1_C 163 331 5.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126004
SMART Domains Protein: ENSMUSP00000115652
Gene: ENSMUSG00000030851

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 1.1e-49 PFAM
Pfam:Ldh_1_C 163 236 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148565
SMART Domains Protein: ENSMUSP00000114206
Gene: ENSMUSG00000030851

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 1.1e-49 PFAM
Pfam:Ldh_1_C 163 234 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210585
Predicted Effect probably null
Transcript: ENSMUST00000211784
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lactate dehydrogenase C catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. LDHC is testis-specific and belongs to the lactate dehydrogenase family. Two transcript variants have been detected which differ in the 5' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous male mice are infertile. Spermatogenesis appears normal, but sperm motility decreases rapidly after their release from the epididymus. In vitro fertilization is blocked unless the zona pellucida is removed; even then, the rate of sperm penetration is lower than for wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Ldhc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03290:Ldhc APN 7 46869688 missense probably damaging 1.00
R1970:Ldhc UTSW 7 46869751 missense probably benign 0.09
R2133:Ldhc UTSW 7 46869599 missense probably damaging 1.00
R4277:Ldhc UTSW 7 46866466 missense probably benign 0.01
R5449:Ldhc UTSW 7 46869658 missense possibly damaging 0.82
R6713:Ldhc UTSW 7 46866531 splice site probably null
R8856:Ldhc UTSW 7 46876575 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTCTAACAATTTGGGGATGGG -3'
(R):5'- TACGCCAGCAACGTTTACAC -3'

Sequencing Primer
(F):5'- GATATCAGGAATTTGAGGCCATC -3'
(R):5'- ACGTTTACACCACTCCATATGGG -3'
Posted On2020-07-01