Incidental Mutation 'R8159:Insrr'
ID 633417
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
MMRRC Submission 067585-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.285) question?
Stock # R8159 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87704258-87723408 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87707735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 59 (L59H)
Ref Sequence ENSEMBL: ENSMUSP00000029711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: L59H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: L59H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: L59H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: L59H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 C A 3: 59,843,843 (GRCm39) P179Q probably damaging Het
Abcc1 C T 16: 14,290,794 (GRCm39) T1468I probably damaging Het
Adrb3 A C 8: 27,718,099 (GRCm39) C117G probably benign Het
Aff4 A T 11: 53,302,721 (GRCm39) S1065C possibly damaging Het
Agrn G A 4: 156,256,825 (GRCm39) A1260V probably benign Het
Auts2 A G 5: 131,488,963 (GRCm39) probably null Het
BC005537 T A 13: 24,993,916 (GRCm39) H159Q probably benign Het
Cacna2d4 A G 6: 119,274,488 (GRCm39) D625G probably benign Het
Cd72 A G 4: 43,450,174 (GRCm39) Y245H probably damaging Het
Ceacam20 G T 7: 19,710,109 (GRCm39) V378L probably damaging Het
Chpf C T 1: 75,455,436 (GRCm39) R105K probably null Het
Chst9 A T 18: 15,585,365 (GRCm39) Y399* probably null Het
Cntn5 A G 9: 10,145,386 (GRCm39) I108T possibly damaging Het
Col14a1 A G 15: 55,291,324 (GRCm39) T931A unknown Het
D630045J12Rik T C 6: 38,105,410 (GRCm39) H1890R probably damaging Het
Dkk2 T C 3: 131,880,739 (GRCm39) I128T probably benign Het
Ece2 C T 16: 20,430,534 (GRCm39) P54S probably damaging Het
Fhip2a T C 19: 57,372,697 (GRCm39) probably null Het
Fry A T 5: 150,322,998 (GRCm39) T1050S probably benign Het
Gfra2 A G 14: 71,133,397 (GRCm39) K76E probably damaging Het
Gigyf1 A T 5: 137,520,457 (GRCm39) D423V unknown Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Herc1 A G 9: 66,369,003 (GRCm39) Q403R probably null Het
Hes5 A G 4: 155,045,502 (GRCm39) N17S probably benign Het
Irs1 A C 1: 82,266,290 (GRCm39) I642S probably damaging Het
Mettl22 T C 16: 8,306,633 (GRCm39) V363A probably benign Het
Notch2 A G 3: 98,028,238 (GRCm39) H983R possibly damaging Het
Nynrin T G 14: 56,100,587 (GRCm39) S126A probably damaging Het
Nynrin A T 14: 56,102,517 (GRCm39) M729L probably benign Het
Or51v14 G A 7: 103,261,347 (GRCm39) T71I possibly damaging Het
Or7e178 A C 9: 20,226,015 (GRCm39) I67S possibly damaging Het
Otof C T 5: 30,537,538 (GRCm39) G1257D probably benign Het
Pals2 A T 6: 50,171,527 (GRCm39) E392V probably benign Het
Pcdhgc5 A G 18: 37,954,175 (GRCm39) E483G probably benign Het
Phldb2 T C 16: 45,680,747 (GRCm39) E20G possibly damaging Het
Ptprz1 A G 6: 23,001,662 (GRCm39) I1251V probably benign Het
Rfx2 A T 17: 57,110,605 (GRCm39) M127K probably benign Het
Slc9a3 A G 13: 74,312,407 (GRCm39) N668S probably benign Het
Smg6 G A 11: 74,929,465 (GRCm39) V965M probably damaging Het
Spen A T 4: 141,202,314 (GRCm39) H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 (GRCm39) E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 (GRCm39) S1755G probably benign Het
Sycp2 A C 2: 177,996,770 (GRCm39) S1144R probably damaging Het
Tsen54 T A 11: 115,711,804 (GRCm39) L407* probably null Het
Uba1y T A Y: 828,806 (GRCm39) I538K possibly damaging Het
Vil1 C A 1: 74,463,136 (GRCm39) H440N probably benign Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87,720,981 (GRCm39) critical splice donor site probably null
IGL00801:Insrr APN 3 87,721,115 (GRCm39) missense probably damaging 1.00
IGL01628:Insrr APN 3 87,708,099 (GRCm39) nonsense probably null
IGL01755:Insrr APN 3 87,721,493 (GRCm39) missense probably damaging 1.00
IGL02100:Insrr APN 3 87,718,927 (GRCm39) missense probably damaging 1.00
IGL02261:Insrr APN 3 87,708,029 (GRCm39) missense probably damaging 1.00
IGL02366:Insrr APN 3 87,717,216 (GRCm39) missense possibly damaging 0.91
IGL02387:Insrr APN 3 87,720,434 (GRCm39) missense probably damaging 1.00
IGL02478:Insrr APN 3 87,716,719 (GRCm39) missense probably benign 0.14
IGL02550:Insrr APN 3 87,711,805 (GRCm39) missense probably damaging 1.00
IGL02555:Insrr APN 3 87,721,124 (GRCm39) missense probably damaging 0.99
IGL02673:Insrr APN 3 87,720,368 (GRCm39) missense possibly damaging 0.95
IGL02724:Insrr APN 3 87,716,879 (GRCm39) missense probably benign 0.31
IGL02798:Insrr APN 3 87,717,824 (GRCm39) missense probably damaging 1.00
IGL02969:Insrr APN 3 87,721,498 (GRCm39) nonsense probably null
IGL03073:Insrr APN 3 87,717,245 (GRCm39) splice site probably benign
IGL03178:Insrr APN 3 87,709,848 (GRCm39) splice site probably null
IGL03389:Insrr APN 3 87,716,038 (GRCm39) missense probably damaging 1.00
IGL03399:Insrr APN 3 87,716,638 (GRCm39) missense probably null 0.99
IGL02799:Insrr UTSW 3 87,720,888 (GRCm39) missense probably damaging 1.00
R0011:Insrr UTSW 3 87,716,923 (GRCm39) missense possibly damaging 0.86
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0357:Insrr UTSW 3 87,715,953 (GRCm39) splice site probably null
R0501:Insrr UTSW 3 87,717,991 (GRCm39) missense probably benign 0.12
R0504:Insrr UTSW 3 87,720,463 (GRCm39) missense possibly damaging 0.69
R0522:Insrr UTSW 3 87,708,179 (GRCm39) missense probably damaging 1.00
R0555:Insrr UTSW 3 87,721,744 (GRCm39) splice site probably benign
R0558:Insrr UTSW 3 87,718,288 (GRCm39) missense possibly damaging 0.77
R0599:Insrr UTSW 3 87,720,440 (GRCm39) missense probably damaging 0.97
R1312:Insrr UTSW 3 87,707,797 (GRCm39) missense probably damaging 1.00
R1694:Insrr UTSW 3 87,711,369 (GRCm39) missense probably benign
R1785:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1786:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1892:Insrr UTSW 3 87,721,184 (GRCm39) missense probably damaging 1.00
R1950:Insrr UTSW 3 87,721,820 (GRCm39) missense probably damaging 1.00
R2080:Insrr UTSW 3 87,721,598 (GRCm39) missense possibly damaging 0.79
R2094:Insrr UTSW 3 87,710,488 (GRCm39) missense probably damaging 1.00
R2130:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2131:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2133:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2220:Insrr UTSW 3 87,716,725 (GRCm39) missense probably damaging 1.00
R2259:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R2404:Insrr UTSW 3 87,709,974 (GRCm39) missense possibly damaging 0.71
R4027:Insrr UTSW 3 87,716,906 (GRCm39) missense probably benign
R4042:Insrr UTSW 3 87,721,134 (GRCm39) missense probably damaging 1.00
R4510:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4511:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4571:Insrr UTSW 3 87,708,194 (GRCm39) missense probably benign
R4870:Insrr UTSW 3 87,718,911 (GRCm39) missense probably damaging 1.00
R5057:Insrr UTSW 3 87,722,572 (GRCm39) missense probably benign 0.00
R5393:Insrr UTSW 3 87,718,007 (GRCm39) splice site probably null
R5685:Insrr UTSW 3 87,707,803 (GRCm39) splice site probably null
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6047:Insrr UTSW 3 87,711,483 (GRCm39) missense probably damaging 1.00
R6276:Insrr UTSW 3 87,707,826 (GRCm39) nonsense probably null
R6298:Insrr UTSW 3 87,720,272 (GRCm39) missense probably damaging 1.00
R6726:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6727:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6728:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6796:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R7041:Insrr UTSW 3 87,722,551 (GRCm39) missense probably damaging 1.00
R7169:Insrr UTSW 3 87,715,901 (GRCm39) missense probably benign 0.15
R7270:Insrr UTSW 3 87,710,440 (GRCm39) missense probably damaging 1.00
R7340:Insrr UTSW 3 87,721,623 (GRCm39) critical splice donor site probably null
R7398:Insrr UTSW 3 87,716,039 (GRCm39) missense probably damaging 1.00
R7473:Insrr UTSW 3 87,711,838 (GRCm39) splice site probably null
R7815:Insrr UTSW 3 87,716,002 (GRCm39) missense probably damaging 0.98
R8289:Insrr UTSW 3 87,721,501 (GRCm39) missense probably damaging 1.00
R8309:Insrr UTSW 3 87,717,749 (GRCm39) missense probably benign 0.00
R8312:Insrr UTSW 3 87,707,791 (GRCm39) missense possibly damaging 0.93
R8445:Insrr UTSW 3 87,720,891 (GRCm39) missense probably damaging 1.00
R8917:Insrr UTSW 3 87,718,276 (GRCm39) missense probably benign 0.00
R8960:Insrr UTSW 3 87,720,386 (GRCm39) missense probably damaging 1.00
R8989:Insrr UTSW 3 87,722,664 (GRCm39) missense probably damaging 0.96
R9015:Insrr UTSW 3 87,720,910 (GRCm39) missense probably damaging 1.00
R9202:Insrr UTSW 3 87,720,427 (GRCm39) missense probably damaging 1.00
R9251:Insrr UTSW 3 87,717,391 (GRCm39) missense probably benign 0.08
R9327:Insrr UTSW 3 87,721,604 (GRCm39) missense probably damaging 1.00
R9646:Insrr UTSW 3 87,721,805 (GRCm39) missense probably damaging 1.00
RF022:Insrr UTSW 3 87,711,792 (GRCm39) missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87,708,134 (GRCm39) missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87,709,886 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGGTCTTCGCTGAGGTG -3'
(R):5'- GGCATCTCAAAGATAATGAGTGCG -3'

Sequencing Primer
(F):5'- AGGGAACTTGGTACTGTCCACTC -3'
(R):5'- CTCAAAGATAATGAGTGCGTAGCCC -3'
Posted On 2020-07-13