Incidental Mutation 'R8159:Auts2'
ID633427
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8159 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 131460125 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect probably null
Transcript: ENSMUST00000161374
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161804
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162101
Predicted Effect probably null
Transcript: ENSMUST00000187544
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C T 16: 14,472,930 T1468I probably damaging Het
Adrb3 A C 8: 27,228,071 C117G probably benign Het
Aff4 A T 11: 53,411,894 S1065C possibly damaging Het
Agrn G A 4: 156,172,368 A1260V probably benign Het
BC005537 T A 13: 24,809,933 H159Q probably benign Het
C130079G13Rik C A 3: 59,936,422 P179Q probably damaging Het
Cacna2d4 A G 6: 119,297,527 D625G probably benign Het
Cd72 A G 4: 43,450,174 Y245H probably damaging Het
Ceacam20 G T 7: 19,976,184 V378L probably damaging Het
Chpf C T 1: 75,478,792 R105K probably null Het
Chst9 A T 18: 15,452,308 Y399* probably null Het
Cntn5 A G 9: 10,145,381 I108T possibly damaging Het
Col14a1 A G 15: 55,427,928 T931A unknown Het
D630045J12Rik T C 6: 38,128,475 H1890R probably damaging Het
Dkk2 T C 3: 132,174,978 I128T probably benign Het
Ece2 C T 16: 20,611,784 P54S probably damaging Het
Fam160b1 T C 19: 57,384,265 probably null Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gfra2 A G 14: 70,895,957 K76E probably damaging Het
Gigyf1 A T 5: 137,522,195 D423V unknown Het
Gpr180 G A 14: 118,153,890 G235R probably damaging Het
Herc1 A G 9: 66,461,721 Q403R probably null Het
Hes5 A G 4: 154,961,045 N17S probably benign Het
Insrr T A 3: 87,800,428 L59H probably damaging Het
Irs1 A C 1: 82,288,569 I642S probably damaging Het
Mettl22 T C 16: 8,488,769 V363A probably benign Het
Mpp6 A T 6: 50,194,547 E392V probably benign Het
Notch2 A G 3: 98,120,922 H983R possibly damaging Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Nynrin A T 14: 55,865,060 M729L probably benign Het
Olfr18 A C 9: 20,314,719 I67S possibly damaging Het
Olfr620 G A 7: 103,612,140 T71I possibly damaging Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Pcdhgc5 A G 18: 37,821,122 E483G probably benign Het
Phldb2 T C 16: 45,860,384 E20G possibly damaging Het
Ptprz1 A G 6: 23,001,663 I1251V probably benign Het
Rfx2 A T 17: 56,803,605 M127K probably benign Het
Slc9a3 A G 13: 74,164,288 N668S probably benign Het
Smg6 G A 11: 75,038,639 V965M probably damaging Het
Spen A T 4: 141,475,003 H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 S1755G probably benign Het
Sycp2 A C 2: 178,354,977 S1144R probably damaging Het
Tsen54 T A 11: 115,820,978 L407* probably null Het
Uba1y T A Y: 828,806 I538K possibly damaging Het
Vil1 C A 1: 74,423,977 H440N probably benign Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
R7812:Auts2 UTSW 5 131472446 missense
R7922:Auts2 UTSW 5 131440373 missense
R8553:Auts2 UTSW 5 131440143 missense probably benign 0.00
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CGAAAGGCCGTTTCCCATC -3'
(R):5'- GTCACTGCATGTTCTGGGGC -3'

Sequencing Primer
(F):5'- ATCTCCCTGCCTGCAAAC -3'
(R):5'- CATGTTCTGGGGCTCCTGAG -3'
Posted On2020-07-13