Incidental Mutation 'R8159:Adrb3'
ID 633437
Institutional Source Beutler Lab
Gene Symbol Adrb3
Ensembl Gene ENSMUSG00000031489
Gene Name adrenergic receptor, beta 3
Synonyms Beta-3 AR, beta 3-AR, Beta-3 adrenoceptor, Adrb-3, beta3-adrenergic receptor
MMRRC Submission 067585-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R8159 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 27715804-27720833 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 27718099 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 117 (C117G)
Ref Sequence ENSEMBL: ENSMUSP00000113732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081438] [ENSMUST00000117565] [ENSMUST00000121838] [ENSMUST00000209299]
AlphaFold P25962
Predicted Effect probably benign
Transcript: ENSMUST00000081438
AA Change: C117G

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080162
Gene: ENSMUSG00000031489
AA Change: C117G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117565
AA Change: C117G

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113732
Gene: ENSMUSG00000031489
AA Change: C117G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.8e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.4e-14 PFAM
Pfam:7tm_1 51 343 4.9e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121838
AA Change: C117G

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113006
Gene: ENSMUSG00000031489
AA Change: C117G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for targeted null mutations develop greater adiposity, especially on a high-fat diet, and are unresponsive to the beta3-adrenergic receptor agonist, CL316,243. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 C A 3: 59,843,843 (GRCm39) P179Q probably damaging Het
Abcc1 C T 16: 14,290,794 (GRCm39) T1468I probably damaging Het
Aff4 A T 11: 53,302,721 (GRCm39) S1065C possibly damaging Het
Agrn G A 4: 156,256,825 (GRCm39) A1260V probably benign Het
Auts2 A G 5: 131,488,963 (GRCm39) probably null Het
BC005537 T A 13: 24,993,916 (GRCm39) H159Q probably benign Het
Cacna2d4 A G 6: 119,274,488 (GRCm39) D625G probably benign Het
Cd72 A G 4: 43,450,174 (GRCm39) Y245H probably damaging Het
Ceacam20 G T 7: 19,710,109 (GRCm39) V378L probably damaging Het
Chpf C T 1: 75,455,436 (GRCm39) R105K probably null Het
Chst9 A T 18: 15,585,365 (GRCm39) Y399* probably null Het
Cntn5 A G 9: 10,145,386 (GRCm39) I108T possibly damaging Het
Col14a1 A G 15: 55,291,324 (GRCm39) T931A unknown Het
D630045J12Rik T C 6: 38,105,410 (GRCm39) H1890R probably damaging Het
Dkk2 T C 3: 131,880,739 (GRCm39) I128T probably benign Het
Ece2 C T 16: 20,430,534 (GRCm39) P54S probably damaging Het
Fhip2a T C 19: 57,372,697 (GRCm39) probably null Het
Fry A T 5: 150,322,998 (GRCm39) T1050S probably benign Het
Gfra2 A G 14: 71,133,397 (GRCm39) K76E probably damaging Het
Gigyf1 A T 5: 137,520,457 (GRCm39) D423V unknown Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Herc1 A G 9: 66,369,003 (GRCm39) Q403R probably null Het
Hes5 A G 4: 155,045,502 (GRCm39) N17S probably benign Het
Insrr T A 3: 87,707,735 (GRCm39) L59H probably damaging Het
Irs1 A C 1: 82,266,290 (GRCm39) I642S probably damaging Het
Mettl22 T C 16: 8,306,633 (GRCm39) V363A probably benign Het
Notch2 A G 3: 98,028,238 (GRCm39) H983R possibly damaging Het
Nynrin T G 14: 56,100,587 (GRCm39) S126A probably damaging Het
Nynrin A T 14: 56,102,517 (GRCm39) M729L probably benign Het
Or51v14 G A 7: 103,261,347 (GRCm39) T71I possibly damaging Het
Or7e178 A C 9: 20,226,015 (GRCm39) I67S possibly damaging Het
Otof C T 5: 30,537,538 (GRCm39) G1257D probably benign Het
Pals2 A T 6: 50,171,527 (GRCm39) E392V probably benign Het
Pcdhgc5 A G 18: 37,954,175 (GRCm39) E483G probably benign Het
Phldb2 T C 16: 45,680,747 (GRCm39) E20G possibly damaging Het
Ptprz1 A G 6: 23,001,662 (GRCm39) I1251V probably benign Het
Rfx2 A T 17: 57,110,605 (GRCm39) M127K probably benign Het
Slc9a3 A G 13: 74,312,407 (GRCm39) N668S probably benign Het
Smg6 G A 11: 74,929,465 (GRCm39) V965M probably damaging Het
Spen A T 4: 141,202,314 (GRCm39) H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 (GRCm39) E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 (GRCm39) S1755G probably benign Het
Sycp2 A C 2: 177,996,770 (GRCm39) S1144R probably damaging Het
Tsen54 T A 11: 115,711,804 (GRCm39) L407* probably null Het
Uba1y T A Y: 828,806 (GRCm39) I538K possibly damaging Het
Vil1 C A 1: 74,463,136 (GRCm39) H440N probably benign Het
Other mutations in Adrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0639:Adrb3 UTSW 8 27,718,293 (GRCm39) missense probably damaging 0.97
R0786:Adrb3 UTSW 8 27,716,880 (GRCm39) unclassified probably benign
R1370:Adrb3 UTSW 8 27,717,798 (GRCm39) splice site probably null
R1449:Adrb3 UTSW 8 27,717,415 (GRCm39) missense probably damaging 1.00
R1874:Adrb3 UTSW 8 27,717,591 (GRCm39) missense probably damaging 1.00
R3426:Adrb3 UTSW 8 27,718,209 (GRCm39) missense probably damaging 1.00
R3428:Adrb3 UTSW 8 27,718,209 (GRCm39) missense probably damaging 1.00
R4941:Adrb3 UTSW 8 27,717,450 (GRCm39) missense probably damaging 1.00
R4989:Adrb3 UTSW 8 27,717,798 (GRCm39) missense probably damaging 1.00
R4994:Adrb3 UTSW 8 27,717,855 (GRCm39) splice site probably null
R5133:Adrb3 UTSW 8 27,717,798 (GRCm39) missense probably damaging 1.00
R5134:Adrb3 UTSW 8 27,717,798 (GRCm39) missense probably damaging 1.00
R5162:Adrb3 UTSW 8 27,717,348 (GRCm39) missense probably benign 0.25
R5342:Adrb3 UTSW 8 27,716,809 (GRCm39) nonsense probably null
R5656:Adrb3 UTSW 8 27,717,405 (GRCm39) missense probably damaging 0.99
R9020:Adrb3 UTSW 8 27,717,947 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGAGCATAGACGAAGAGC -3'
(R):5'- TAATCATAGCCATCGCCCGC -3'

Sequencing Primer
(F):5'- CAGCGCATAGGGCATGTTG -3'
(R):5'- GCACGCCGAGACTACAG -3'
Posted On 2020-07-13