Incidental Mutation 'R8159:Aff4'
ID 633441
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission 067585-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8159 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53241660-53312657 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53302721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 1065 (S1065C)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect possibly damaging
Transcript: ENSMUST00000060945
AA Change: S1065C

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: S1065C

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 C A 3: 59,843,843 (GRCm39) P179Q probably damaging Het
Abcc1 C T 16: 14,290,794 (GRCm39) T1468I probably damaging Het
Adrb3 A C 8: 27,718,099 (GRCm39) C117G probably benign Het
Agrn G A 4: 156,256,825 (GRCm39) A1260V probably benign Het
Auts2 A G 5: 131,488,963 (GRCm39) probably null Het
BC005537 T A 13: 24,993,916 (GRCm39) H159Q probably benign Het
Cacna2d4 A G 6: 119,274,488 (GRCm39) D625G probably benign Het
Cd72 A G 4: 43,450,174 (GRCm39) Y245H probably damaging Het
Ceacam20 G T 7: 19,710,109 (GRCm39) V378L probably damaging Het
Chpf C T 1: 75,455,436 (GRCm39) R105K probably null Het
Chst9 A T 18: 15,585,365 (GRCm39) Y399* probably null Het
Cntn5 A G 9: 10,145,386 (GRCm39) I108T possibly damaging Het
Col14a1 A G 15: 55,291,324 (GRCm39) T931A unknown Het
D630045J12Rik T C 6: 38,105,410 (GRCm39) H1890R probably damaging Het
Dkk2 T C 3: 131,880,739 (GRCm39) I128T probably benign Het
Ece2 C T 16: 20,430,534 (GRCm39) P54S probably damaging Het
Fhip2a T C 19: 57,372,697 (GRCm39) probably null Het
Fry A T 5: 150,322,998 (GRCm39) T1050S probably benign Het
Gfra2 A G 14: 71,133,397 (GRCm39) K76E probably damaging Het
Gigyf1 A T 5: 137,520,457 (GRCm39) D423V unknown Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Herc1 A G 9: 66,369,003 (GRCm39) Q403R probably null Het
Hes5 A G 4: 155,045,502 (GRCm39) N17S probably benign Het
Insrr T A 3: 87,707,735 (GRCm39) L59H probably damaging Het
Irs1 A C 1: 82,266,290 (GRCm39) I642S probably damaging Het
Mettl22 T C 16: 8,306,633 (GRCm39) V363A probably benign Het
Notch2 A G 3: 98,028,238 (GRCm39) H983R possibly damaging Het
Nynrin T G 14: 56,100,587 (GRCm39) S126A probably damaging Het
Nynrin A T 14: 56,102,517 (GRCm39) M729L probably benign Het
Or51v14 G A 7: 103,261,347 (GRCm39) T71I possibly damaging Het
Or7e178 A C 9: 20,226,015 (GRCm39) I67S possibly damaging Het
Otof C T 5: 30,537,538 (GRCm39) G1257D probably benign Het
Pals2 A T 6: 50,171,527 (GRCm39) E392V probably benign Het
Pcdhgc5 A G 18: 37,954,175 (GRCm39) E483G probably benign Het
Phldb2 T C 16: 45,680,747 (GRCm39) E20G possibly damaging Het
Ptprz1 A G 6: 23,001,662 (GRCm39) I1251V probably benign Het
Rfx2 A T 17: 57,110,605 (GRCm39) M127K probably benign Het
Slc9a3 A G 13: 74,312,407 (GRCm39) N668S probably benign Het
Smg6 G A 11: 74,929,465 (GRCm39) V965M probably damaging Het
Spen A T 4: 141,202,314 (GRCm39) H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 (GRCm39) E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 (GRCm39) S1755G probably benign Het
Sycp2 A C 2: 177,996,770 (GRCm39) S1144R probably damaging Het
Tsen54 T A 11: 115,711,804 (GRCm39) L407* probably null Het
Uba1y T A Y: 828,806 (GRCm39) I538K possibly damaging Het
Vil1 C A 1: 74,463,136 (GRCm39) H440N probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53,302,817 (GRCm39) missense probably damaging 0.98
IGL01348:Aff4 APN 11 53,293,327 (GRCm39) missense probably benign
IGL01446:Aff4 APN 11 53,306,296 (GRCm39) missense probably damaging 0.99
IGL02151:Aff4 APN 11 53,290,633 (GRCm39) missense probably benign
IGL02526:Aff4 APN 11 53,297,509 (GRCm39) splice site probably benign
IGL02567:Aff4 APN 11 53,263,578 (GRCm39) missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53,300,198 (GRCm39) splice site probably benign
IGL02707:Aff4 APN 11 53,290,567 (GRCm39) missense probably benign
R0090:Aff4 UTSW 11 53,283,609 (GRCm39) missense probably benign 0.01
R0128:Aff4 UTSW 11 53,306,293 (GRCm39) missense probably damaging 0.99
R0243:Aff4 UTSW 11 53,288,685 (GRCm39) missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53,263,708 (GRCm39) missense probably benign 0.00
R0347:Aff4 UTSW 11 53,290,915 (GRCm39) missense probably benign 0.01
R0732:Aff4 UTSW 11 53,266,423 (GRCm39) missense probably benign
R0737:Aff4 UTSW 11 53,301,780 (GRCm39) nonsense probably null
R1464:Aff4 UTSW 11 53,263,351 (GRCm39) missense probably damaging 0.97
R1464:Aff4 UTSW 11 53,263,351 (GRCm39) missense probably damaging 0.97
R1500:Aff4 UTSW 11 53,263,205 (GRCm39) missense probably benign 0.00
R1693:Aff4 UTSW 11 53,287,380 (GRCm39) missense probably damaging 1.00
R1743:Aff4 UTSW 11 53,259,522 (GRCm39) missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53,263,826 (GRCm39) missense probably damaging 1.00
R2048:Aff4 UTSW 11 53,289,212 (GRCm39) missense probably benign 0.39
R2138:Aff4 UTSW 11 53,263,339 (GRCm39) missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53,290,446 (GRCm39) missense probably damaging 1.00
R2379:Aff4 UTSW 11 53,299,305 (GRCm39) splice site probably benign
R4156:Aff4 UTSW 11 53,301,726 (GRCm39) intron probably benign
R5001:Aff4 UTSW 11 53,295,184 (GRCm39) missense probably damaging 1.00
R5281:Aff4 UTSW 11 53,263,115 (GRCm39) missense probably damaging 1.00
R5477:Aff4 UTSW 11 53,299,299 (GRCm39) critical splice donor site probably null
R5677:Aff4 UTSW 11 53,291,102 (GRCm39) missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53,263,837 (GRCm39) missense probably damaging 0.99
R6576:Aff4 UTSW 11 53,291,268 (GRCm39) missense probably damaging 1.00
R6764:Aff4 UTSW 11 53,290,657 (GRCm39) missense probably damaging 1.00
R6988:Aff4 UTSW 11 53,289,064 (GRCm39) missense probably damaging 1.00
R7034:Aff4 UTSW 11 53,299,236 (GRCm39) missense probably damaging 0.99
R7177:Aff4 UTSW 11 53,297,466 (GRCm39) missense probably benign 0.10
R7426:Aff4 UTSW 11 53,263,702 (GRCm39) missense probably damaging 1.00
R7755:Aff4 UTSW 11 53,289,206 (GRCm39) missense probably damaging 0.97
R7848:Aff4 UTSW 11 53,295,339 (GRCm39) missense probably benign 0.05
R7968:Aff4 UTSW 11 53,300,175 (GRCm39) missense probably damaging 1.00
R8218:Aff4 UTSW 11 53,289,084 (GRCm39) missense probably damaging 0.98
R8241:Aff4 UTSW 11 53,290,998 (GRCm39) missense probably benign 0.00
R8284:Aff4 UTSW 11 53,295,379 (GRCm39) missense probably damaging 0.99
R8373:Aff4 UTSW 11 53,291,094 (GRCm39) nonsense probably null
R8695:Aff4 UTSW 11 53,259,509 (GRCm39) missense probably damaging 1.00
R8777:Aff4 UTSW 11 53,290,783 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53,290,783 (GRCm39) missense probably damaging 1.00
R8780:Aff4 UTSW 11 53,271,444 (GRCm39) missense probably damaging 1.00
R8798:Aff4 UTSW 11 53,291,335 (GRCm39) critical splice donor site probably benign
R8838:Aff4 UTSW 11 53,297,465 (GRCm39) missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53,263,231 (GRCm39) missense probably benign
R9146:Aff4 UTSW 11 53,298,963 (GRCm39) missense probably benign 0.06
R9329:Aff4 UTSW 11 53,288,686 (GRCm39) missense probably damaging 1.00
R9378:Aff4 UTSW 11 53,263,306 (GRCm39) missense probably damaging 0.98
R9471:Aff4 UTSW 11 53,271,473 (GRCm39) missense probably benign 0.13
R9779:Aff4 UTSW 11 53,263,734 (GRCm39) nonsense probably null
R9796:Aff4 UTSW 11 53,302,824 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAGTTGACAGTCCATCTTATTTTCC -3'
(R):5'- CAAAGTTTATCCAGTGCCCAAC -3'

Sequencing Primer
(F):5'- GGTAACAAGTGCTCTCTCACTGAG -3'
(R):5'- AGTGCCCAACAAACCTTTTTG -3'
Posted On 2020-07-13