Mutagenetix > Incidental Mutations

Incidental Mutation 'R8159:Aff4'

633441

Institutional Source

Beutler Lab

Gene Symbol

Aff4

Ensembl Gene

ENSMUSG00000049470

Gene Name

AF4/FMR2 family, member 4

Synonyms

Laf4l, Alf4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8159 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53350833-53421830 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53411894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 1065 (S1065C)

Ref Sequence

ENSEMBL: ENSMUSP00000051479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060945]

AlphaFold

Q9ESC8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060945
AA Change: S1065C

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: S1065C

Domain	Start	End	E-Value	Type
Pfam:AF-4	2	1156	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	T	16: 14,472,930	T1468I	probably damaging	Het
Adrb3	A	C	8: 27,228,071	C117G	probably benign	Het
Agrn	G	A	4: 156,172,368	A1260V	probably benign	Het
Auts2	A	G	5: 131,460,125		probably null	Het
BC005537	T	A	13: 24,809,933	H159Q	probably benign	Het
C130079G13Rik	C	A	3: 59,936,422	P179Q	probably damaging	Het
Cacna2d4	A	G	6: 119,297,527	D625G	probably benign	Het
Cd72	A	G	4: 43,450,174	Y245H	probably damaging	Het
Ceacam20	G	T	7: 19,976,184	V378L	probably damaging	Het
Chpf	C	T	1: 75,478,792	R105K	probably null	Het
Chst9	A	T	18: 15,452,308	Y399*	probably null	Het
Cntn5	A	G	9: 10,145,381	I108T	possibly damaging	Het
Col14a1	A	G	15: 55,427,928	T931A	unknown	Het
D630045J12Rik	T	C	6: 38,128,475	H1890R	probably damaging	Het
Dkk2	T	C	3: 132,174,978	I128T	probably benign	Het
Ece2	C	T	16: 20,611,784	P54S	probably damaging	Het
Fam160b1	T	C	19: 57,384,265		probably null	Het
Fry	A	T	5: 150,399,533	T1050S	probably benign	Het
Gfra2	A	G	14: 70,895,957	K76E	probably damaging	Het
Gigyf1	A	T	5: 137,522,195	D423V	unknown	Het
Gpr180	G	A	14: 118,153,890	G235R	probably damaging	Het
Herc1	A	G	9: 66,461,721	Q403R	probably null	Het
Hes5	A	G	4: 154,961,045	N17S	probably benign	Het
Insrr	T	A	3: 87,800,428	L59H	probably damaging	Het
Irs1	A	C	1: 82,288,569	I642S	probably damaging	Het
Mettl22	T	C	16: 8,488,769	V363A	probably benign	Het
Mpp6	A	T	6: 50,194,547	E392V	probably benign	Het
Notch2	A	G	3: 98,120,922	H983R	possibly damaging	Het
Nynrin	T	G	14: 55,863,130	S126A	probably damaging	Het
Nynrin	A	T	14: 55,865,060	M729L	probably benign	Het
Olfr18	A	C	9: 20,314,719	I67S	possibly damaging	Het
Olfr620	G	A	7: 103,612,140	T71I	possibly damaging	Het
Otof	C	T	5: 30,380,194	G1257D	probably benign	Het
Pcdhgc5	A	G	18: 37,821,122	E483G	probably benign	Het
Phldb2	T	C	16: 45,860,384	E20G	possibly damaging	Het
Ptprz1	A	G	6: 23,001,663	I1251V	probably benign	Het
Rfx2	A	T	17: 56,803,605	M127K	probably benign	Het
Slc9a3	A	G	13: 74,164,288	N668S	probably benign	Het
Smg6	G	A	11: 75,038,639	V965M	probably damaging	Het
Spen	A	T	4: 141,475,003	H2104Q	possibly damaging	Het
Svep1	C	T	4: 58,069,396	E2797K	possibly damaging	Het
Svep1	T	C	4: 58,087,815	S1755G	probably benign	Het
Sycp2	A	C	2: 178,354,977	S1144R	probably damaging	Het
Tsen54	T	A	11: 115,820,978	L407*	probably null	Het
Uba1y	T	A	Y: 828,806	I538K	possibly damaging	Het
Vil1	C	A	1: 74,423,977	H440N	probably benign	Het

Other mutations in Aff4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Aff4	APN	11	53411990	missense	probably damaging	0.98
IGL01348:Aff4	APN	11	53402500	missense	probably benign
IGL01446:Aff4	APN	11	53415469	missense	probably damaging	0.99
IGL02151:Aff4	APN	11	53399806	missense	probably benign
IGL02526:Aff4	APN	11	53406682	splice site	probably benign
IGL02567:Aff4	APN	11	53372751	missense	possibly damaging	0.64
IGL02633:Aff4	APN	11	53409371	splice site	probably benign
IGL02707:Aff4	APN	11	53399740	missense	probably benign
R0090:Aff4	UTSW	11	53392782	missense	probably benign	0.01
R0128:Aff4	UTSW	11	53415466	missense	probably damaging	0.99
R0243:Aff4	UTSW	11	53397858	missense	possibly damaging	0.74
R0345:Aff4	UTSW	11	53372881	missense	probably benign	0.00
R0347:Aff4	UTSW	11	53400088	missense	probably benign	0.01
R0732:Aff4	UTSW	11	53375596	missense	probably benign
R0737:Aff4	UTSW	11	53410953	nonsense	probably null
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1500:Aff4	UTSW	11	53372378	missense	probably benign	0.00
R1693:Aff4	UTSW	11	53396553	missense	probably damaging	1.00
R1743:Aff4	UTSW	11	53368695	missense	possibly damaging	0.65
R1961:Aff4	UTSW	11	53372999	missense	probably damaging	1.00
R2048:Aff4	UTSW	11	53398385	missense	probably benign	0.39
R2138:Aff4	UTSW	11	53372512	missense	possibly damaging	0.94
R2155:Aff4	UTSW	11	53399619	missense	probably damaging	1.00
R2379:Aff4	UTSW	11	53408478	splice site	probably benign
R4156:Aff4	UTSW	11	53410899	intron	probably benign
R5001:Aff4	UTSW	11	53404357	missense	probably damaging	1.00
R5281:Aff4	UTSW	11	53372288	missense	probably damaging	1.00
R5477:Aff4	UTSW	11	53408472	critical splice donor site	probably null
R5677:Aff4	UTSW	11	53400275	missense	possibly damaging	0.55
R5992:Aff4	UTSW	11	53373010	missense	probably damaging	0.99
R6576:Aff4	UTSW	11	53400441	missense	probably damaging	1.00
R6764:Aff4	UTSW	11	53399830	missense	probably damaging	1.00
R6988:Aff4	UTSW	11	53398237	missense	probably damaging	1.00
R7034:Aff4	UTSW	11	53408409	missense	probably damaging	0.99
R7177:Aff4	UTSW	11	53406639	missense	probably benign	0.10
R7426:Aff4	UTSW	11	53372875	missense	probably damaging	1.00
R7755:Aff4	UTSW	11	53398379	missense	probably damaging	0.97
R7848:Aff4	UTSW	11	53404512	missense	probably benign	0.05
R7968:Aff4	UTSW	11	53409348	missense	probably damaging	1.00
R8218:Aff4	UTSW	11	53398257	missense	probably damaging	0.98
R8241:Aff4	UTSW	11	53400171	missense	probably benign	0.00
R8284:Aff4	UTSW	11	53404552	missense	probably damaging	0.99
R8373:Aff4	UTSW	11	53400267	nonsense	probably null
R8695:Aff4	UTSW	11	53368682	missense	probably damaging	1.00
R8777:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8777-TAIL:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8780:Aff4	UTSW	11	53380617	missense	probably damaging	1.00
R8798:Aff4	UTSW	11	53400508	critical splice donor site	probably benign
R8838:Aff4	UTSW	11	53406638	missense	possibly damaging	0.77
R8939:Aff4	UTSW	11	53372404	missense	probably benign
R9146:Aff4	UTSW	11	53408136	missense	probably benign	0.06
R9329:Aff4	UTSW	11	53397859	missense	probably damaging	1.00
R9378:Aff4	UTSW	11	53372479	missense	probably damaging	0.98
R9471:Aff4	UTSW	11	53380646	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GTGAGTTGACAGTCCATCTTATTTTCC -3'
(R):5'- CAAAGTTTATCCAGTGCCCAAC -3'

Sequencing Primer
(F):5'- GGTAACAAGTGCTCTCTCACTGAG -3'
(R):5'- AGTGCCCAACAAACCTTTTTG -3'

Posted On

2020-07-13