Incidental Mutation 'R8159:Aff4'
ID 633441
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8159 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53411894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 1065 (S1065C)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect possibly damaging
Transcript: ENSMUST00000060945
AA Change: S1065C

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: S1065C

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C T 16: 14,472,930 T1468I probably damaging Het
Adrb3 A C 8: 27,228,071 C117G probably benign Het
Agrn G A 4: 156,172,368 A1260V probably benign Het
Auts2 A G 5: 131,460,125 probably null Het
BC005537 T A 13: 24,809,933 H159Q probably benign Het
C130079G13Rik C A 3: 59,936,422 P179Q probably damaging Het
Cacna2d4 A G 6: 119,297,527 D625G probably benign Het
Cd72 A G 4: 43,450,174 Y245H probably damaging Het
Ceacam20 G T 7: 19,976,184 V378L probably damaging Het
Chpf C T 1: 75,478,792 R105K probably null Het
Chst9 A T 18: 15,452,308 Y399* probably null Het
Cntn5 A G 9: 10,145,381 I108T possibly damaging Het
Col14a1 A G 15: 55,427,928 T931A unknown Het
D630045J12Rik T C 6: 38,128,475 H1890R probably damaging Het
Dkk2 T C 3: 132,174,978 I128T probably benign Het
Ece2 C T 16: 20,611,784 P54S probably damaging Het
Fam160b1 T C 19: 57,384,265 probably null Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gfra2 A G 14: 70,895,957 K76E probably damaging Het
Gigyf1 A T 5: 137,522,195 D423V unknown Het
Gpr180 G A 14: 118,153,890 G235R probably damaging Het
Herc1 A G 9: 66,461,721 Q403R probably null Het
Hes5 A G 4: 154,961,045 N17S probably benign Het
Insrr T A 3: 87,800,428 L59H probably damaging Het
Irs1 A C 1: 82,288,569 I642S probably damaging Het
Mettl22 T C 16: 8,488,769 V363A probably benign Het
Mpp6 A T 6: 50,194,547 E392V probably benign Het
Notch2 A G 3: 98,120,922 H983R possibly damaging Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Nynrin A T 14: 55,865,060 M729L probably benign Het
Olfr18 A C 9: 20,314,719 I67S possibly damaging Het
Olfr620 G A 7: 103,612,140 T71I possibly damaging Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Pcdhgc5 A G 18: 37,821,122 E483G probably benign Het
Phldb2 T C 16: 45,860,384 E20G possibly damaging Het
Ptprz1 A G 6: 23,001,663 I1251V probably benign Het
Rfx2 A T 17: 56,803,605 M127K probably benign Het
Slc9a3 A G 13: 74,164,288 N668S probably benign Het
Smg6 G A 11: 75,038,639 V965M probably damaging Het
Spen A T 4: 141,475,003 H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 S1755G probably benign Het
Sycp2 A C 2: 178,354,977 S1144R probably damaging Het
Tsen54 T A 11: 115,820,978 L407* probably null Het
Uba1y T A Y: 828,806 I538K possibly damaging Het
Vil1 C A 1: 74,423,977 H440N probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTGAGTTGACAGTCCATCTTATTTTCC -3'
(R):5'- CAAAGTTTATCCAGTGCCCAAC -3'

Sequencing Primer
(F):5'- GGTAACAAGTGCTCTCTCACTGAG -3'
(R):5'- AGTGCCCAACAAACCTTTTTG -3'
Posted On 2020-07-13