Incidental Mutation 'R8159:Slc9a3'
ID 633445
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8159 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74164288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 668 (N668S)
Ref Sequence ENSEMBL: ENSMUSP00000038142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208]
AlphaFold G3X939
Predicted Effect probably benign
Transcript: ENSMUST00000036208
AA Change: N668S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: N668S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C T 16: 14,472,930 T1468I probably damaging Het
Adrb3 A C 8: 27,228,071 C117G probably benign Het
Aff4 A T 11: 53,411,894 S1065C possibly damaging Het
Agrn G A 4: 156,172,368 A1260V probably benign Het
Auts2 A G 5: 131,460,125 probably null Het
BC005537 T A 13: 24,809,933 H159Q probably benign Het
C130079G13Rik C A 3: 59,936,422 P179Q probably damaging Het
Cacna2d4 A G 6: 119,297,527 D625G probably benign Het
Cd72 A G 4: 43,450,174 Y245H probably damaging Het
Ceacam20 G T 7: 19,976,184 V378L probably damaging Het
Chpf C T 1: 75,478,792 R105K probably null Het
Chst9 A T 18: 15,452,308 Y399* probably null Het
Cntn5 A G 9: 10,145,381 I108T possibly damaging Het
Col14a1 A G 15: 55,427,928 T931A unknown Het
D630045J12Rik T C 6: 38,128,475 H1890R probably damaging Het
Dkk2 T C 3: 132,174,978 I128T probably benign Het
Ece2 C T 16: 20,611,784 P54S probably damaging Het
Fam160b1 T C 19: 57,384,265 probably null Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gfra2 A G 14: 70,895,957 K76E probably damaging Het
Gigyf1 A T 5: 137,522,195 D423V unknown Het
Gpr180 G A 14: 118,153,890 G235R probably damaging Het
Herc1 A G 9: 66,461,721 Q403R probably null Het
Hes5 A G 4: 154,961,045 N17S probably benign Het
Insrr T A 3: 87,800,428 L59H probably damaging Het
Irs1 A C 1: 82,288,569 I642S probably damaging Het
Mettl22 T C 16: 8,488,769 V363A probably benign Het
Mpp6 A T 6: 50,194,547 E392V probably benign Het
Notch2 A G 3: 98,120,922 H983R possibly damaging Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Nynrin A T 14: 55,865,060 M729L probably benign Het
Olfr18 A C 9: 20,314,719 I67S possibly damaging Het
Olfr620 G A 7: 103,612,140 T71I possibly damaging Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Pcdhgc5 A G 18: 37,821,122 E483G probably benign Het
Phldb2 T C 16: 45,860,384 E20G possibly damaging Het
Ptprz1 A G 6: 23,001,663 I1251V probably benign Het
Rfx2 A T 17: 56,803,605 M127K probably benign Het
Smg6 G A 11: 75,038,639 V965M probably damaging Het
Spen A T 4: 141,475,003 H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 S1755G probably benign Het
Sycp2 A C 2: 178,354,977 S1144R probably damaging Het
Tsen54 T A 11: 115,820,978 L407* probably null Het
Uba1y T A Y: 828,806 I538K possibly damaging Het
Vil1 C A 1: 74,423,977 H440N probably benign Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCTTCTTCTCAGACAAGGG -3'
(R):5'- TGCAGGAATTTGGTCTCTGCTC -3'

Sequencing Primer
(F):5'- ATGAGCTGGAGATCCTGTGACC -3'
(R):5'- GTCTCTGCTCTGGTGAAAGTC -3'
Posted On 2020-07-13