Mutagenetix > Incidental Mutation

Incidental Mutation 'R8159:Slc9a3'

633445

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

067585-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8159 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74164288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 668 (N668S)

Ref Sequence

ENSEMBL: ENSMUSP00000038142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208]

AlphaFold

G3X939

Predicted Effect

probably benign
Transcript: ENSMUST00000036208
AA Change: N668S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: N668S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	T	16: 14,472,930	T1468I	probably damaging	Het
Adrb3	A	C	8: 27,228,071	C117G	probably benign	Het
Aff4	A	T	11: 53,411,894	S1065C	possibly damaging	Het
Agrn	G	A	4: 156,172,368	A1260V	probably benign	Het
Auts2	A	G	5: 131,460,125		probably null	Het
BC005537	T	A	13: 24,809,933	H159Q	probably benign	Het
C130079G13Rik	C	A	3: 59,936,422	P179Q	probably damaging	Het
Cacna2d4	A	G	6: 119,297,527	D625G	probably benign	Het
Cd72	A	G	4: 43,450,174	Y245H	probably damaging	Het
Ceacam20	G	T	7: 19,976,184	V378L	probably damaging	Het
Chpf	C	T	1: 75,478,792	R105K	probably null	Het
Chst9	A	T	18: 15,452,308	Y399*	probably null	Het
Cntn5	A	G	9: 10,145,381	I108T	possibly damaging	Het
Col14a1	A	G	15: 55,427,928	T931A	unknown	Het
D630045J12Rik	T	C	6: 38,128,475	H1890R	probably damaging	Het
Dkk2	T	C	3: 132,174,978	I128T	probably benign	Het
Ece2	C	T	16: 20,611,784	P54S	probably damaging	Het
Fam160b1	T	C	19: 57,384,265		probably null	Het
Fry	A	T	5: 150,399,533	T1050S	probably benign	Het
Gfra2	A	G	14: 70,895,957	K76E	probably damaging	Het
Gigyf1	A	T	5: 137,522,195	D423V	unknown	Het
Gpr180	G	A	14: 118,153,890	G235R	probably damaging	Het
Herc1	A	G	9: 66,461,721	Q403R	probably null	Het
Hes5	A	G	4: 154,961,045	N17S	probably benign	Het
Insrr	T	A	3: 87,800,428	L59H	probably damaging	Het
Irs1	A	C	1: 82,288,569	I642S	probably damaging	Het
Mettl22	T	C	16: 8,488,769	V363A	probably benign	Het
Mpp6	A	T	6: 50,194,547	E392V	probably benign	Het
Notch2	A	G	3: 98,120,922	H983R	possibly damaging	Het
Nynrin	T	G	14: 55,863,130	S126A	probably damaging	Het
Nynrin	A	T	14: 55,865,060	M729L	probably benign	Het
Olfr18	A	C	9: 20,314,719	I67S	possibly damaging	Het
Olfr620	G	A	7: 103,612,140	T71I	possibly damaging	Het
Otof	C	T	5: 30,380,194	G1257D	probably benign	Het
Pcdhgc5	A	G	18: 37,821,122	E483G	probably benign	Het
Phldb2	T	C	16: 45,860,384	E20G	possibly damaging	Het
Ptprz1	A	G	6: 23,001,663	I1251V	probably benign	Het
Rfx2	A	T	17: 56,803,605	M127K	probably benign	Het
Smg6	G	A	11: 75,038,639	V965M	probably damaging	Het
Spen	A	T	4: 141,475,003	H2104Q	possibly damaging	Het
Svep1	C	T	4: 58,069,396	E2797K	possibly damaging	Het
Svep1	T	C	4: 58,087,815	S1755G	probably benign	Het
Sycp2	A	C	2: 178,354,977	S1144R	probably damaging	Het
Tsen54	T	A	11: 115,820,978	L407*	probably null	Het
Uba1y	T	A	Y: 828,806	I538K	possibly damaging	Het
Vil1	C	A	1: 74,423,977	H440N	probably benign	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
R9741:Slc9a3	UTSW	13	74158875	missense	possibly damaging	0.95
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCTTCTTCTCAGACAAGGG -3'
(R):5'- TGCAGGAATTTGGTCTCTGCTC -3'

Sequencing Primer
(F):5'- ATGAGCTGGAGATCCTGTGACC -3'
(R):5'- GTCTCTGCTCTGGTGAAAGTC -3'

Posted On

2020-07-13