Incidental Mutation 'R8159:Rfx2'
ID 633455
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Name regulatory factor X, 2 (influences HLA class II expression)
Synonyms 5430432H19Rik
MMRRC Submission 067585-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.786) question?
Stock # R8159 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 57082897-57138013 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57110605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 127 (M127K)
Ref Sequence ENSEMBL: ENSMUSP00000002444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
AlphaFold P48379
Predicted Effect probably benign
Transcript: ENSMUST00000002444
AA Change: M127K

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: M127K

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000086801
AA Change: M127K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: M127K

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Meta Mutation Damage Score 0.4991 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 C A 3: 59,843,843 (GRCm39) P179Q probably damaging Het
Abcc1 C T 16: 14,290,794 (GRCm39) T1468I probably damaging Het
Adrb3 A C 8: 27,718,099 (GRCm39) C117G probably benign Het
Aff4 A T 11: 53,302,721 (GRCm39) S1065C possibly damaging Het
Agrn G A 4: 156,256,825 (GRCm39) A1260V probably benign Het
Auts2 A G 5: 131,488,963 (GRCm39) probably null Het
BC005537 T A 13: 24,993,916 (GRCm39) H159Q probably benign Het
Cacna2d4 A G 6: 119,274,488 (GRCm39) D625G probably benign Het
Cd72 A G 4: 43,450,174 (GRCm39) Y245H probably damaging Het
Ceacam20 G T 7: 19,710,109 (GRCm39) V378L probably damaging Het
Chpf C T 1: 75,455,436 (GRCm39) R105K probably null Het
Chst9 A T 18: 15,585,365 (GRCm39) Y399* probably null Het
Cntn5 A G 9: 10,145,386 (GRCm39) I108T possibly damaging Het
Col14a1 A G 15: 55,291,324 (GRCm39) T931A unknown Het
D630045J12Rik T C 6: 38,105,410 (GRCm39) H1890R probably damaging Het
Dkk2 T C 3: 131,880,739 (GRCm39) I128T probably benign Het
Ece2 C T 16: 20,430,534 (GRCm39) P54S probably damaging Het
Fhip2a T C 19: 57,372,697 (GRCm39) probably null Het
Fry A T 5: 150,322,998 (GRCm39) T1050S probably benign Het
Gfra2 A G 14: 71,133,397 (GRCm39) K76E probably damaging Het
Gigyf1 A T 5: 137,520,457 (GRCm39) D423V unknown Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Herc1 A G 9: 66,369,003 (GRCm39) Q403R probably null Het
Hes5 A G 4: 155,045,502 (GRCm39) N17S probably benign Het
Insrr T A 3: 87,707,735 (GRCm39) L59H probably damaging Het
Irs1 A C 1: 82,266,290 (GRCm39) I642S probably damaging Het
Mettl22 T C 16: 8,306,633 (GRCm39) V363A probably benign Het
Notch2 A G 3: 98,028,238 (GRCm39) H983R possibly damaging Het
Nynrin T G 14: 56,100,587 (GRCm39) S126A probably damaging Het
Nynrin A T 14: 56,102,517 (GRCm39) M729L probably benign Het
Or51v14 G A 7: 103,261,347 (GRCm39) T71I possibly damaging Het
Or7e178 A C 9: 20,226,015 (GRCm39) I67S possibly damaging Het
Otof C T 5: 30,537,538 (GRCm39) G1257D probably benign Het
Pals2 A T 6: 50,171,527 (GRCm39) E392V probably benign Het
Pcdhgc5 A G 18: 37,954,175 (GRCm39) E483G probably benign Het
Phldb2 T C 16: 45,680,747 (GRCm39) E20G possibly damaging Het
Ptprz1 A G 6: 23,001,662 (GRCm39) I1251V probably benign Het
Slc9a3 A G 13: 74,312,407 (GRCm39) N668S probably benign Het
Smg6 G A 11: 74,929,465 (GRCm39) V965M probably damaging Het
Spen A T 4: 141,202,314 (GRCm39) H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 (GRCm39) E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 (GRCm39) S1755G probably benign Het
Sycp2 A C 2: 177,996,770 (GRCm39) S1144R probably damaging Het
Tsen54 T A 11: 115,711,804 (GRCm39) L407* probably null Het
Uba1y T A Y: 828,806 (GRCm39) I538K possibly damaging Het
Vil1 C A 1: 74,463,136 (GRCm39) H440N probably benign Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 57,090,657 (GRCm39) missense probably damaging 1.00
IGL01296:Rfx2 APN 17 57,115,317 (GRCm39) start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 57,112,398 (GRCm39) missense probably damaging 1.00
IGL01705:Rfx2 APN 17 57,092,303 (GRCm39) missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 57,115,325 (GRCm39) splice site probably benign
IGL02601:Rfx2 APN 17 57,092,354 (GRCm39) missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 57,112,404 (GRCm39) missense probably benign 0.00
R0066:Rfx2 UTSW 17 57,093,736 (GRCm39) splice site probably benign
R0066:Rfx2 UTSW 17 57,093,736 (GRCm39) splice site probably benign
R0197:Rfx2 UTSW 17 57,110,722 (GRCm39) missense probably damaging 0.99
R0370:Rfx2 UTSW 17 57,106,308 (GRCm39) missense probably benign 0.03
R0413:Rfx2 UTSW 17 57,091,418 (GRCm39) splice site probably benign
R0622:Rfx2 UTSW 17 57,084,071 (GRCm39) missense probably damaging 0.99
R0883:Rfx2 UTSW 17 57,110,722 (GRCm39) missense probably damaging 0.99
R1429:Rfx2 UTSW 17 57,111,369 (GRCm39) missense probably damaging 0.97
R1439:Rfx2 UTSW 17 57,094,720 (GRCm39) missense probably damaging 1.00
R1569:Rfx2 UTSW 17 57,111,326 (GRCm39) missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 57,115,263 (GRCm39) missense probably benign 0.00
R1751:Rfx2 UTSW 17 57,091,754 (GRCm39) missense probably benign 0.01
R1816:Rfx2 UTSW 17 57,115,305 (GRCm39) nonsense probably null
R2282:Rfx2 UTSW 17 57,110,722 (GRCm39) missense probably damaging 0.99
R3408:Rfx2 UTSW 17 57,110,526 (GRCm39) missense probably benign 0.00
R3962:Rfx2 UTSW 17 57,092,302 (GRCm39) missense probably damaging 0.99
R4415:Rfx2 UTSW 17 57,094,733 (GRCm39) missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 57,091,706 (GRCm39) missense probably benign 0.00
R4883:Rfx2 UTSW 17 57,090,747 (GRCm39) missense probably damaging 0.98
R5588:Rfx2 UTSW 17 57,086,890 (GRCm39) missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 57,110,587 (GRCm39) missense probably benign 0.02
R5798:Rfx2 UTSW 17 57,111,362 (GRCm39) missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 57,087,778 (GRCm39) missense probably damaging 0.99
R6061:Rfx2 UTSW 17 57,084,473 (GRCm39) missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 57,091,397 (GRCm39) missense probably benign 0.13
R6800:Rfx2 UTSW 17 57,087,804 (GRCm39) missense probably damaging 0.99
R7329:Rfx2 UTSW 17 57,110,681 (GRCm39) missense probably benign 0.05
R7476:Rfx2 UTSW 17 57,110,527 (GRCm39) missense probably benign 0.31
R8274:Rfx2 UTSW 17 57,111,348 (GRCm39) missense probably benign 0.00
R8838:Rfx2 UTSW 17 57,087,877 (GRCm39) missense possibly damaging 0.91
R8964:Rfx2 UTSW 17 57,093,696 (GRCm39) missense probably damaging 1.00
R9663:Rfx2 UTSW 17 57,087,895 (GRCm39) missense possibly damaging 0.67
R9786:Rfx2 UTSW 17 57,087,890 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCCCAATCCTAAAGGCCTTTG -3'
(R):5'- AGGGCTCTGTTAAAGCCCATTG -3'

Sequencing Primer
(F):5'- TCACCTACCTGAGTGCTGG -3'
(R):5'- AAAGCCCATTGTCTCCTTTAGATC -3'
Posted On 2020-07-13