Incidental Mutation 'R8159:Rfx2'
ID633455
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
Synonyms5430432H19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R8159 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56803605 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 127 (M127K)
Ref Sequence ENSEMBL: ENSMUSP00000002444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
AA Change: M127K

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: M127K

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000086801
AA Change: M127K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: M127K

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Meta Mutation Damage Score 0.4991 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C T 16: 14,472,930 T1468I probably damaging Het
Adrb3 A C 8: 27,228,071 C117G probably benign Het
Aff4 A T 11: 53,411,894 S1065C possibly damaging Het
Agrn G A 4: 156,172,368 A1260V probably benign Het
Auts2 A G 5: 131,460,125 probably null Het
BC005537 T A 13: 24,809,933 H159Q probably benign Het
C130079G13Rik C A 3: 59,936,422 P179Q probably damaging Het
Cacna2d4 A G 6: 119,297,527 D625G probably benign Het
Cd72 A G 4: 43,450,174 Y245H probably damaging Het
Ceacam20 G T 7: 19,976,184 V378L probably damaging Het
Chpf C T 1: 75,478,792 R105K probably null Het
Chst9 A T 18: 15,452,308 Y399* probably null Het
Cntn5 A G 9: 10,145,381 I108T possibly damaging Het
Col14a1 A G 15: 55,427,928 T931A unknown Het
D630045J12Rik T C 6: 38,128,475 H1890R probably damaging Het
Dkk2 T C 3: 132,174,978 I128T probably benign Het
Ece2 C T 16: 20,611,784 P54S probably damaging Het
Fam160b1 T C 19: 57,384,265 probably null Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gfra2 A G 14: 70,895,957 K76E probably damaging Het
Gigyf1 A T 5: 137,522,195 D423V unknown Het
Gpr180 G A 14: 118,153,890 G235R probably damaging Het
Herc1 A G 9: 66,461,721 Q403R probably null Het
Hes5 A G 4: 154,961,045 N17S probably benign Het
Insrr T A 3: 87,800,428 L59H probably damaging Het
Irs1 A C 1: 82,288,569 I642S probably damaging Het
Mettl22 T C 16: 8,488,769 V363A probably benign Het
Mpp6 A T 6: 50,194,547 E392V probably benign Het
Notch2 A G 3: 98,120,922 H983R possibly damaging Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Nynrin A T 14: 55,865,060 M729L probably benign Het
Olfr18 A C 9: 20,314,719 I67S possibly damaging Het
Olfr620 G A 7: 103,612,140 T71I possibly damaging Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Pcdhgc5 A G 18: 37,821,122 E483G probably benign Het
Phldb2 T C 16: 45,860,384 E20G possibly damaging Het
Ptprz1 A G 6: 23,001,663 I1251V probably benign Het
Slc9a3 A G 13: 74,164,288 N668S probably benign Het
Smg6 G A 11: 75,038,639 V965M probably damaging Het
Spen A T 4: 141,475,003 H2104Q possibly damaging Het
Svep1 C T 4: 58,069,396 E2797K possibly damaging Het
Svep1 T C 4: 58,087,815 S1755G probably benign Het
Sycp2 A C 2: 178,354,977 S1144R probably damaging Het
Tsen54 T A 11: 115,820,978 L407* probably null Het
Uba1y T A Y: 828,806 I538K possibly damaging Het
Vil1 C A 1: 74,423,977 H440N probably benign Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0622:Rfx2 UTSW 17 56777071 missense probably damaging 0.99
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3408:Rfx2 UTSW 17 56803526 missense probably benign 0.00
R3962:Rfx2 UTSW 17 56785302 missense probably damaging 0.99
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5588:Rfx2 UTSW 17 56779890 missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
R7329:Rfx2 UTSW 17 56803681 missense probably benign 0.05
R7476:Rfx2 UTSW 17 56803527 missense probably benign 0.31
R8274:Rfx2 UTSW 17 56804348 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCAATCCTAAAGGCCTTTG -3'
(R):5'- AGGGCTCTGTTAAAGCCCATTG -3'

Sequencing Primer
(F):5'- TCACCTACCTGAGTGCTGG -3'
(R):5'- AAAGCCCATTGTCTCCTTTAGATC -3'
Posted On2020-07-13