Incidental Mutation 'R8160:Ccl20'
ID 633461
Institutional Source Beutler Lab
Gene Symbol Ccl20
Ensembl Gene ENSMUSG00000026166
Gene Name chemokine (C-C motif) ligand 20
Synonyms MIP-3[a], MIP3A, ST38, exodus-1, CKb4, MIP-3A, Scya20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R8160 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 83116766-83119167 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83117822 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 35 (S35T)
Ref Sequence ENSEMBL: ENSMUSP00000027351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027351] [ENSMUST00000113437] [ENSMUST00000186832]
AlphaFold O89093
Predicted Effect
SMART Domains Protein: ENSMUSP00000027351
Gene: ENSMUSG00000026166
AA Change: S35T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCY 30 90 9.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113437
AA Change: S36T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109064
Gene: ENSMUSG00000026166
AA Change: S36T

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
SCY 30 90 9.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186832
AA Change: S35T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139923
Gene: ENSMUSG00000026166
AA Change: S35T

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
SCY 29 89 9.36e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Ccl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Ccl20 APN 1 83118078 critical splice donor site probably null
IGL03372:Ccl20 APN 1 83117876 missense probably benign 0.03
R0969:Ccl20 UTSW 1 83117917 splice site probably benign
R1794:Ccl20 UTSW 1 83117829 missense possibly damaging 0.74
R1818:Ccl20 UTSW 1 83117808 missense probably damaging 0.96
R1897:Ccl20 UTSW 1 83117895 missense probably damaging 1.00
R2001:Ccl20 UTSW 1 83117855 frame shift probably null
R4885:Ccl20 UTSW 1 83117859 missense possibly damaging 0.94
R7062:Ccl20 UTSW 1 83117814 missense probably damaging 1.00
R9349:Ccl20 UTSW 1 83117865 missense
Predicted Primers PCR Primer
(F):5'- AAGCCATGGTCTTGTGAATTG -3'
(R):5'- CCCAGTTCTGCTTTGGATCAG -3'

Sequencing Primer
(F):5'- GTGTTAGTTAAACCAAAACATCCCAG -3'
(R):5'- TGGATCAGCGCACACAGATTTTC -3'
Posted On 2020-07-13