Incidental Mutation 'R8160:Nsun6'
ID633463
Institutional Source Beutler Lab
Gene Symbol Nsun6
Ensembl Gene ENSMUSG00000026707
Gene NameNOL1/NOP2/Sun domain family member 6
Synonyms4933414E04Rik, 4933403D21Rik, NOPD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14995131-15055069 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 15009408 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028034] [ENSMUST00000076435] [ENSMUST00000114715] [ENSMUST00000195749]
Predicted Effect probably null
Transcript: ENSMUST00000028034
SMART Domains Protein: ENSMUSP00000028034
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076435
SMART Domains Protein: ENSMUSP00000075766
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 224 392 4.7e-9 PFAM
Pfam:Nol1_Nop2_Fmu 227 464 4.7e-48 PFAM
Pfam:Methyltransf_31 232 423 8.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114715
SMART Domains Protein: ENSMUSP00000110363
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 61 152 1.96e-4 SMART
Pfam:FtsJ 165 346 4.5e-9 PFAM
Pfam:Methyltransf_31 181 372 2.3e-10 PFAM
Pfam:Methyltransf_18 183 322 2.8e-9 PFAM
Pfam:Methyltransf_26 184 323 5.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195749
SMART Domains Protein: ENSMUSP00000141924
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Nsun6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Nsun6 APN 2 15048978 missense possibly damaging 0.69
IGL02347:Nsun6 APN 2 15030020 splice site probably benign
IGL03352:Nsun6 APN 2 14996346 nonsense probably null
R0371:Nsun6 UTSW 2 15030087 missense probably damaging 1.00
R0639:Nsun6 UTSW 2 14996336 missense probably benign
R0737:Nsun6 UTSW 2 14996474 missense probably damaging 1.00
R1076:Nsun6 UTSW 2 15009472 missense probably benign 0.01
R1676:Nsun6 UTSW 2 15047213 nonsense probably null
R1842:Nsun6 UTSW 2 15009477 missense probably damaging 0.98
R1989:Nsun6 UTSW 2 15038184 missense probably benign
R2091:Nsun6 UTSW 2 15039731 critical splice donor site probably null
R2972:Nsun6 UTSW 2 15038072 critical splice donor site probably null
R3276:Nsun6 UTSW 2 15009404 splice site probably benign
R4386:Nsun6 UTSW 2 14996522 missense probably benign 0.05
R4761:Nsun6 UTSW 2 15030061 missense possibly damaging 0.88
R4782:Nsun6 UTSW 2 15036326 missense possibly damaging 0.88
R6701:Nsun6 UTSW 2 15036302 missense probably benign 0.00
R6890:Nsun6 UTSW 2 15048977 missense probably damaging 1.00
R7555:Nsun6 UTSW 2 14996339 missense possibly damaging 0.73
R7587:Nsun6 UTSW 2 15039825 missense probably benign
R7880:Nsun6 UTSW 2 14996379 missense probably damaging 0.99
R7888:Nsun6 UTSW 2 14996544 missense probably benign 0.01
R8458:Nsun6 UTSW 2 15030052 missense probably benign
R8784:Nsun6 UTSW 2 14996495 nonsense probably null
Z1177:Nsun6 UTSW 2 15030103 missense probably damaging 1.00
Z1177:Nsun6 UTSW 2 15039820 missense probably benign
Z1192:Nsun6 UTSW 2 15038107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCAAGCATCCCAAATC -3'
(R):5'- AAAGTCTTATTGCTCTGGTATGGC -3'

Sequencing Primer
(F):5'- CAAGGGCCATTCATGTTGTAGCAC -3'
(R):5'- TAAGCATTCTTAGCTTAGTCAAGCAC -3'
Posted On2020-07-13