Incidental Mutation 'R8160:Nostrin'
ID633465
Institutional Source Beutler Lab
Gene Symbol Nostrin
Ensembl Gene ENSMUSG00000034738
Gene Namenitric oxide synthase trafficker
SynonymsmDaIP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69135800-69189330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69179466 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 313 (I313F)
Ref Sequence ENSEMBL: ENSMUSP00000036923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041865]
Predicted Effect probably damaging
Transcript: ENSMUST00000041865
AA Change: I313F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: I313F

DomainStartEndE-ValueType
Pfam:FCH 13 88 4.9e-12 PFAM
low complexity region 135 146 N/A INTRINSIC
coiled coil region 160 190 N/A INTRINSIC
coiled coil region 305 334 N/A INTRINSIC
low complexity region 419 439 N/A INTRINSIC
SH3 441 496 8.89e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Nostrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nostrin APN 2 69185554 splice site probably benign
IGL00502:Nostrin APN 2 69183992 missense probably benign
IGL00767:Nostrin APN 2 69175775 missense probably benign 0.00
IGL00846:Nostrin APN 2 69185555 splice site probably benign
IGL00912:Nostrin APN 2 69182819 splice site probably benign
IGL02123:Nostrin APN 2 69156109 splice site probably benign
IGL02213:Nostrin APN 2 69183918 missense probably benign 0.25
R0295:Nostrin UTSW 2 69179416 missense probably benign 0.19
R0543:Nostrin UTSW 2 69189131 makesense probably null
R1384:Nostrin UTSW 2 69189062 missense probably benign 0.05
R1501:Nostrin UTSW 2 69158785 missense probably damaging 1.00
R1632:Nostrin UTSW 2 69175734 missense probably benign 0.21
R2012:Nostrin UTSW 2 69144767 splice site probably null
R2140:Nostrin UTSW 2 69166003 missense probably damaging 0.98
R2159:Nostrin UTSW 2 69180922 splice site probably null
R2329:Nostrin UTSW 2 69161094 missense probably damaging 1.00
R2890:Nostrin UTSW 2 69180905 missense probably benign
R4469:Nostrin UTSW 2 69175717 missense probably damaging 0.99
R4607:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4608:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4684:Nostrin UTSW 2 69183924 missense probably benign 0.00
R4719:Nostrin UTSW 2 69144812 nonsense probably null
R4846:Nostrin UTSW 2 69175579 missense probably damaging 1.00
R4911:Nostrin UTSW 2 69161142 missense possibly damaging 0.87
R4987:Nostrin UTSW 2 69156431 missense probably benign
R5054:Nostrin UTSW 2 69175713 missense possibly damaging 0.82
R5177:Nostrin UTSW 2 69175754 missense possibly damaging 0.83
R6561:Nostrin UTSW 2 69180857 missense probably benign
R6785:Nostrin UTSW 2 69183927 missense probably benign 0.01
R6789:Nostrin UTSW 2 69175512 missense probably benign
R7453:Nostrin UTSW 2 69183896 missense possibly damaging 0.95
R7465:Nostrin UTSW 2 69185507 missense possibly damaging 0.93
R7570:Nostrin UTSW 2 69175806 missense probably damaging 0.98
R7761:Nostrin UTSW 2 69161122 missense possibly damaging 0.88
R7802:Nostrin UTSW 2 69189012 missense probably benign 0.18
R8115:Nostrin UTSW 2 69180920 critical splice donor site probably null
R8844:Nostrin UTSW 2 69175716 missense probably damaging 0.99
R9046:Nostrin UTSW 2 69144779 missense probably benign
X0021:Nostrin UTSW 2 69144792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCAGTGACTCTCATTTCTCC -3'
(R):5'- TCCCCTTATCCAGTACTGAAGG -3'

Sequencing Primer
(F):5'- CTTACACTGGGCAGGAACTTG -3'
(R):5'- TTATCCAGTACTGAAGGACATCAC -3'
Posted On2020-07-13