Mutagenetix > Incidental Mutations

Incidental Mutation 'R8160:Nostrin'

633465

Institutional Source

Beutler Lab

Gene Symbol

Nostrin

Ensembl Gene

ENSMUSG00000034738

Gene Name

nitric oxide synthase trafficker

Synonyms

mDaIP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R8160 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69135800-69189330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69179466 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 313 (I313F)

Ref Sequence

ENSEMBL: ENSMUSP00000036923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041865]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041865
AA Change: I313F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: I313F

Domain	Start	End	E-Value	Type
Pfam:FCH	13	88	4.9e-12	PFAM
low complexity region	135	146	N/A	INTRINSIC
coiled coil region	160	190	N/A	INTRINSIC
coiled coil region	305	334	N/A	INTRINSIC
low complexity region	419	439	N/A	INTRINSIC
SH3	441	496	8.89e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415F15Rik	T	C	11: 11,487,734	S246P	unknown	Het
Adam12	C	T	7: 133,968,041		probably null	Het
Aldh8a1	A	G	10: 21,395,791	D472G	possibly damaging	Het
Appl1	T	C	14: 26,928,635	I527V	probably benign	Het
Arhgef4	C	A	1: 34,723,574	T637K	unknown	Het
Atp7b	G	A	8: 21,997,559	A1273V	probably damaging	Het
Ccl20	T	A	1: 83,117,822	S35T		Het
Cdh24	C	A	14: 54,638,489	V208F	probably damaging	Het
Dchs2	A	T	3: 83,270,805	Q1055L	probably benign	Het
Dock8	G	A	19: 25,147,347	R1009Q	probably damaging	Het
Ext2	A	T	2: 93,813,762	V58E	probably benign	Het
Fam208a	T	A	14: 27,449,956	N420K	probably damaging	Het
Fam209	A	T	2: 172,472,725	I45F	possibly damaging	Het
Hfm1	T	C	5: 106,896,033	Y579C	probably null	Het
Hipk4	C	T	7: 27,523,761	A82V	possibly damaging	Het
Il17rc	A	G	6: 113,476,528	Y223C	possibly damaging	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Kdm5b	T	A	1: 134,613,919	M744K	probably damaging	Het
Mettl16	T	C	11: 74,817,679	V568A	probably damaging	Het
Mink1	C	T	11: 70,606,081	Q422*	probably null	Het
Mvb12b	G	T	2: 33,840,222	D81E	probably benign	Het
Nsun6	A	G	2: 15,009,408		probably null	Het
Nt5dc1	T	A	10: 34,324,396	E209V	possibly damaging	Het
Oasl2	T	C	5: 114,901,286		probably benign	Het
Olfr303	C	T	7: 86,395,265	V78M	possibly damaging	Het
Olfr517	C	T	7: 108,868,788	R122Q	possibly damaging	Het
Olfr857	T	A	9: 19,712,789		probably benign	Het
Ppm1h	A	T	10: 122,802,436	T204S	probably benign	Het
Rad51b	T	A	12: 79,303,341	L70I	probably benign	Het
Smok3c	A	G	5: 138,065,024	T258A	possibly damaging	Het
Snai2	T	C	16: 14,706,804	V58A	possibly damaging	Het
St6galnac1	G	A	11: 116,775,490		probably benign	Het

Other mutations in Nostrin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Nostrin	APN	2	69185554	splice site	probably benign
IGL00502:Nostrin	APN	2	69183992	missense	probably benign
IGL00767:Nostrin	APN	2	69175775	missense	probably benign	0.00
IGL00846:Nostrin	APN	2	69185555	splice site	probably benign
IGL00912:Nostrin	APN	2	69182819	splice site	probably benign
IGL02123:Nostrin	APN	2	69156109	splice site	probably benign
IGL02213:Nostrin	APN	2	69183918	missense	probably benign	0.25
R0295:Nostrin	UTSW	2	69179416	missense	probably benign	0.19
R0543:Nostrin	UTSW	2	69189131	makesense	probably null
R1384:Nostrin	UTSW	2	69189062	missense	probably benign	0.05
R1501:Nostrin	UTSW	2	69158785	missense	probably damaging	1.00
R1632:Nostrin	UTSW	2	69175734	missense	probably benign	0.21
R2012:Nostrin	UTSW	2	69144767	splice site	probably null
R2140:Nostrin	UTSW	2	69166003	missense	probably damaging	0.98
R2159:Nostrin	UTSW	2	69180922	splice site	probably null
R2329:Nostrin	UTSW	2	69161094	missense	probably damaging	1.00
R2890:Nostrin	UTSW	2	69180905	missense	probably benign
R4469:Nostrin	UTSW	2	69175717	missense	probably damaging	0.99
R4607:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4608:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4684:Nostrin	UTSW	2	69183924	missense	probably benign	0.00
R4719:Nostrin	UTSW	2	69144812	nonsense	probably null
R4846:Nostrin	UTSW	2	69175579	missense	probably damaging	1.00
R4911:Nostrin	UTSW	2	69161142	missense	possibly damaging	0.87
R4987:Nostrin	UTSW	2	69156431	missense	probably benign
R5054:Nostrin	UTSW	2	69175713	missense	possibly damaging	0.82
R5177:Nostrin	UTSW	2	69175754	missense	possibly damaging	0.83
R6561:Nostrin	UTSW	2	69180857	missense	probably benign
R6785:Nostrin	UTSW	2	69183927	missense	probably benign	0.01
R6789:Nostrin	UTSW	2	69175512	missense	probably benign
R7453:Nostrin	UTSW	2	69183896	missense	possibly damaging	0.95
R7465:Nostrin	UTSW	2	69185507	missense	possibly damaging	0.93
R7570:Nostrin	UTSW	2	69175806	missense	probably damaging	0.98
R7761:Nostrin	UTSW	2	69161122	missense	possibly damaging	0.88
R7802:Nostrin	UTSW	2	69189012	missense	probably benign	0.18
R8115:Nostrin	UTSW	2	69180920	critical splice donor site	probably null
R8844:Nostrin	UTSW	2	69175716	missense	probably damaging	0.99
R9046:Nostrin	UTSW	2	69144779	missense	probably benign
X0021:Nostrin	UTSW	2	69144792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCAGTGACTCTCATTTCTCC -3'
(R):5'- TCCCCTTATCCAGTACTGAAGG -3'

Sequencing Primer
(F):5'- CTTACACTGGGCAGGAACTTG -3'
(R):5'- TTATCCAGTACTGAAGGACATCAC -3'

Posted On

2020-07-13