Incidental Mutation 'R8160:Fam209'
ID633467
Institutional Source Beutler Lab
Gene Symbol Fam209
Ensembl Gene ENSMUSG00000027505
Gene Namefamily with sequence similarity 209
Synonyms1700029J11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location172472520-172474331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172472725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 45 (I45F)
Ref Sequence ENSEMBL: ENSMUSP00000029007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029005] [ENSMUST00000029007]
Predicted Effect probably benign
Transcript: ENSMUST00000029005
SMART Domains Protein: ENSMUSP00000029005
Gene: ENSMUSG00000027502

DomainStartEndE-ValueType
Pfam:Rtf2 1 290 1.5e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000029007
AA Change: I45F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029007
Gene: ENSMUSG00000027505
AA Change: I45F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:FAM209 21 168 9.1e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Fam209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Fam209 APN 2 172474182 missense probably damaging 1.00
R0147:Fam209 UTSW 2 172473980 missense probably damaging 0.99
R0148:Fam209 UTSW 2 172473980 missense probably damaging 0.99
R0558:Fam209 UTSW 2 172472838 missense probably benign 0.01
R0584:Fam209 UTSW 2 172474161 missense probably benign 0.00
R0615:Fam209 UTSW 2 172474133 missense probably benign
R0882:Fam209 UTSW 2 172472635 missense probably benign
R2001:Fam209 UTSW 2 172472769 missense probably benign 0.09
R2002:Fam209 UTSW 2 172472769 missense probably benign 0.09
R3725:Fam209 UTSW 2 172473995 missense probably benign 0.02
R3726:Fam209 UTSW 2 172473995 missense probably benign 0.02
R3892:Fam209 UTSW 2 172472698 missense probably damaging 0.98
R6697:Fam209 UTSW 2 172474203 missense probably damaging 1.00
R7051:Fam209 UTSW 2 172474049 missense probably damaging 0.97
R7052:Fam209 UTSW 2 172472831 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACACTAGCCCATCAGTGTCTC -3'
(R):5'- GTCCTACTTGTAGGAACCTAACCTG -3'

Sequencing Primer
(F):5'- ATCAGTGTCTCTGGCACCACG -3'
(R):5'- AACCTAACCTGGGTTTCTGAGAGC -3'
Posted On2020-07-13