Incidental Mutation 'R8160:Il17rc'
ID633471
Institutional Source Beutler Lab
Gene Symbol Il17rc
Ensembl Gene ENSMUSG00000030281
Gene Nameinterleukin 17 receptor C
Synonyms1110025H02Rik, IL17-RL, Il17rl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113471427-113483140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113476528 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 223 (Y223C)
Ref Sequence ENSEMBL: ENSMUSP00000055343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058300
AA Change: Y223C

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281
AA Change: Y223C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit increased interleukin-17 secretion, reduced chemokine expression, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Il17rc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Il17rc APN 6 113474171 missense probably damaging 0.96
IGL03192:Il17rc APN 6 113472885 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R4075:Il17rc UTSW 6 113481197 missense possibly damaging 0.82
R5025:Il17rc UTSW 6 113472366 missense possibly damaging 0.62
R5052:Il17rc UTSW 6 113472323 missense probably damaging 1.00
R5148:Il17rc UTSW 6 113482997 missense probably benign 0.19
R5302:Il17rc UTSW 6 113483036 missense possibly damaging 0.71
R5977:Il17rc UTSW 6 113482731 missense probably damaging 0.98
R6275:Il17rc UTSW 6 113480347 missense probably benign 0.00
R7010:Il17rc UTSW 6 113479288 missense possibly damaging 0.86
R8031:Il17rc UTSW 6 113482821 missense probably damaging 1.00
R8138:Il17rc UTSW 6 113482539 missense probably damaging 1.00
R8209:Il17rc UTSW 6 113472810 missense probably benign 0.01
R8890:Il17rc UTSW 6 113479070 missense probably damaging 1.00
Z1176:Il17rc UTSW 6 113476795 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGAGAGTCTGAACTTCCCC -3'
(R):5'- AATGTTCTGAGGTCCAGTCTG -3'

Sequencing Primer
(F):5'- GAAGAGAGTCTGAACTTCCCCATCTC -3'
(R):5'- CCAGTCTGTGGGATGAGTAGAC -3'
Posted On2020-07-13