Incidental Mutation 'R8160:Hipk4'
ID633472
Institutional Source Beutler Lab
Gene Symbol Hipk4
Ensembl Gene ENSMUSG00000040424
Gene Namehomeodomain interacting protein kinase 4
SynonymsLOC233020
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27523267-27531175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27523761 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 82 (A82V)
Ref Sequence ENSEMBL: ENSMUSP00000103990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect probably benign
Transcript: ENSMUST00000037134
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065487
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098644
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108353
AA Change: A82V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424
AA Change: A82V

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeodomain interacting protein kinase (HIPK) family of proteins. While other members of this family are found throughout vertebrates, this member is present only in mammals. Compared to other members of this family, the encoded protein lacks a nuclear localization signal and a C-terminal autoinhibitory domain. The encoded protein exhibits kinase activity and may phosphorylate the tumor suppressor protein p53. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Hipk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Hipk4 APN 7 27528543 nonsense probably null
IGL02712:Hipk4 APN 7 27528635 missense probably damaging 1.00
R2018:Hipk4 UTSW 7 27529004 missense probably damaging 1.00
R3813:Hipk4 UTSW 7 27523947 missense probably damaging 1.00
R4796:Hipk4 UTSW 7 27528570 missense probably benign 0.00
R5121:Hipk4 UTSW 7 27529492 missense probably benign 0.02
R5738:Hipk4 UTSW 7 27528416 missense probably damaging 1.00
R5776:Hipk4 UTSW 7 27528980 missense probably damaging 1.00
R6142:Hipk4 UTSW 7 27529165 missense probably damaging 1.00
R6578:Hipk4 UTSW 7 27528387 missense probably damaging 1.00
R7637:Hipk4 UTSW 7 27523548 missense probably damaging 1.00
R8343:Hipk4 UTSW 7 27523608 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGACTGCTACGACATCATTG -3'
(R):5'- TTTCAGGCTTGAGGTCAGCG -3'

Sequencing Primer
(F):5'- CTACGACATCATTGAAGTTCTGGGC -3'
(R):5'- CGTGGATGATGGCCAGTTCC -3'
Posted On2020-07-13