Incidental Mutation 'R8160:Olfr517'
ID633474
Institutional Source Beutler Lab
Gene Symbol Olfr517
Ensembl Gene ENSMUSG00000066240
Gene Nameolfactory receptor 517
SynonymsGA_x6K02T2PBJ9-11199311-11198367, MOR268-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108867208-108872379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108868788 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 122 (R122Q)
Ref Sequence ENSEMBL: ENSMUSP00000081805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084753
AA Change: R122Q

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081805
Gene: ENSMUSG00000066240
AA Change: R122Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.4e-60 PFAM
Pfam:7tm_1 41 299 4.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Olfr517
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Olfr517 APN 7 108868275 missense possibly damaging 0.94
IGL01866:Olfr517 APN 7 108868799 missense possibly damaging 0.95
IGL02131:Olfr517 APN 7 108868208 makesense probably null
IGL02456:Olfr517 APN 7 108869050 missense probably benign 0.19
IGL02604:Olfr517 APN 7 108868650 missense probably benign 0.00
IGL02975:Olfr517 APN 7 108868855 nonsense probably null
R0084:Olfr517 UTSW 7 108868800 missense probably damaging 0.98
R0504:Olfr517 UTSW 7 108868850 missense possibly damaging 0.91
R0748:Olfr517 UTSW 7 108869150 start codon destroyed probably null 1.00
R1428:Olfr517 UTSW 7 108868960 missense probably damaging 0.99
R1907:Olfr517 UTSW 7 108868498 missense possibly damaging 0.78
R2292:Olfr517 UTSW 7 108869016 missense probably benign 0.05
R3874:Olfr517 UTSW 7 108869128 missense probably damaging 0.98
R4091:Olfr517 UTSW 7 108868443 missense probably damaging 1.00
R4873:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R4875:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R5440:Olfr517 UTSW 7 108868626 missense probably damaging 1.00
R5920:Olfr517 UTSW 7 108868688 missense probably benign
R6723:Olfr517 UTSW 7 108868588 missense probably damaging 1.00
R6730:Olfr517 UTSW 7 108868573 missense probably benign 0.09
R6892:Olfr517 UTSW 7 108868515 missense probably damaging 1.00
R7473:Olfr517 UTSW 7 108868269 missense probably damaging 0.98
R8213:Olfr517 UTSW 7 108868519 missense probably benign
R8330:Olfr517 UTSW 7 108868839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAAGCTCCAGTACTGC -3'
(R):5'- GCCTGCATATCCCCATGTAC -3'

Sequencing Primer
(F):5'- CAGTACTGCTGGGGTTTCAC -3'
(R):5'- ATATCCCCATGTACCTGTTCTTGCAG -3'
Posted On2020-07-13