Incidental Mutation 'R8160:Or10a49'
ID 633474
Institutional Source Beutler Lab
Gene Symbol Or10a49
Ensembl Gene ENSMUSG00000066240
Gene Name olfactory receptor family 10 subfamily A member 49
Synonyms MOR268-4, Olfr517, GA_x6K02T2PBJ9-11199311-11198367
MMRRC Submission 067586-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R8160 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 108467415-108468359 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108467995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 122 (R122Q)
Ref Sequence ENSEMBL: ENSMUSP00000081805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084753]
AlphaFold Q7TRU4
Predicted Effect possibly damaging
Transcript: ENSMUST00000084753
AA Change: R122Q

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081805
Gene: ENSMUSG00000066240
AA Change: R122Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.4e-60 PFAM
Pfam:7tm_1 41 299 4.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 C T 7: 133,569,770 (GRCm39) probably null Het
Aldh8a1 A G 10: 21,271,690 (GRCm39) D472G possibly damaging Het
Appl1 T C 14: 26,650,592 (GRCm39) I527V probably benign Het
Arhgef4 C A 1: 34,762,655 (GRCm39) T637K unknown Het
Atp7b G A 8: 22,487,575 (GRCm39) A1273V probably damaging Het
Ccl20 T A 1: 83,095,543 (GRCm39) S35T Het
Cdh24 C A 14: 54,875,946 (GRCm39) V208F probably damaging Het
Dchs2 A T 3: 83,178,112 (GRCm39) Q1055L probably benign Het
Dock8 G A 19: 25,124,711 (GRCm39) R1009Q probably damaging Het
Ext2 A T 2: 93,644,107 (GRCm39) V58E probably benign Het
Fam209 A T 2: 172,314,645 (GRCm39) I45F possibly damaging Het
Hfm1 T C 5: 107,043,899 (GRCm39) Y579C probably null Het
Hipk4 C T 7: 27,223,186 (GRCm39) A82V possibly damaging Het
Il17rc A G 6: 113,453,489 (GRCm39) Y223C possibly damaging Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Kdm5b T A 1: 134,541,657 (GRCm39) M744K probably damaging Het
Mettl16 T C 11: 74,708,505 (GRCm39) V568A probably damaging Het
Mink1 C T 11: 70,496,907 (GRCm39) Q422* probably null Het
Mvb12b G T 2: 33,730,234 (GRCm39) D81E probably benign Het
Nostrin A T 2: 69,009,810 (GRCm39) I313F probably damaging Het
Nsun6 A G 2: 15,014,219 (GRCm39) probably null Het
Nt5dc1 T A 10: 34,200,392 (GRCm39) E209V possibly damaging Het
Oasl2 T C 5: 115,039,347 (GRCm39) probably benign Het
Or6aa1 C T 7: 86,044,473 (GRCm39) V78M possibly damaging Het
Or7e166 T A 9: 19,624,085 (GRCm39) probably benign Het
Ppm1h A T 10: 122,638,341 (GRCm39) T204S probably benign Het
Rad51b T A 12: 79,350,115 (GRCm39) L70I probably benign Het
Smok3c A G 5: 138,063,286 (GRCm39) T258A possibly damaging Het
Snai2 T C 16: 14,524,668 (GRCm39) V58A possibly damaging Het
Spmip7 T C 11: 11,437,734 (GRCm39) S246P unknown Het
St6galnac1 G A 11: 116,666,316 (GRCm39) probably benign Het
Tasor T A 14: 27,171,913 (GRCm39) N420K probably damaging Het
Other mutations in Or10a49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Or10a49 APN 7 108,467,482 (GRCm39) missense possibly damaging 0.94
IGL01866:Or10a49 APN 7 108,468,006 (GRCm39) missense possibly damaging 0.95
IGL02131:Or10a49 APN 7 108,467,415 (GRCm39) makesense probably null
IGL02456:Or10a49 APN 7 108,468,257 (GRCm39) missense probably benign 0.19
IGL02604:Or10a49 APN 7 108,467,857 (GRCm39) missense probably benign 0.00
IGL02975:Or10a49 APN 7 108,468,062 (GRCm39) nonsense probably null
R0084:Or10a49 UTSW 7 108,468,007 (GRCm39) missense probably damaging 0.98
R0504:Or10a49 UTSW 7 108,468,057 (GRCm39) missense possibly damaging 0.91
R0748:Or10a49 UTSW 7 108,468,357 (GRCm39) start codon destroyed probably null 1.00
R1428:Or10a49 UTSW 7 108,468,167 (GRCm39) missense probably damaging 0.99
R1907:Or10a49 UTSW 7 108,467,705 (GRCm39) missense possibly damaging 0.78
R2292:Or10a49 UTSW 7 108,468,223 (GRCm39) missense probably benign 0.05
R3874:Or10a49 UTSW 7 108,468,335 (GRCm39) missense probably damaging 0.98
R4091:Or10a49 UTSW 7 108,467,650 (GRCm39) missense probably damaging 1.00
R4873:Or10a49 UTSW 7 108,467,993 (GRCm39) missense probably damaging 0.99
R4875:Or10a49 UTSW 7 108,467,993 (GRCm39) missense probably damaging 0.99
R5440:Or10a49 UTSW 7 108,467,833 (GRCm39) missense probably damaging 1.00
R5920:Or10a49 UTSW 7 108,467,895 (GRCm39) missense probably benign
R6723:Or10a49 UTSW 7 108,467,795 (GRCm39) missense probably damaging 1.00
R6730:Or10a49 UTSW 7 108,467,780 (GRCm39) missense probably benign 0.09
R6892:Or10a49 UTSW 7 108,467,722 (GRCm39) missense probably damaging 1.00
R7473:Or10a49 UTSW 7 108,467,476 (GRCm39) missense probably damaging 0.98
R8213:Or10a49 UTSW 7 108,467,726 (GRCm39) missense probably benign
R8330:Or10a49 UTSW 7 108,468,046 (GRCm39) missense probably damaging 1.00
R8913:Or10a49 UTSW 7 108,467,809 (GRCm39) missense probably damaging 1.00
R9231:Or10a49 UTSW 7 108,467,840 (GRCm39) missense possibly damaging 0.55
R9585:Or10a49 UTSW 7 108,467,552 (GRCm39) missense probably benign 0.20
R9664:Or10a49 UTSW 7 108,467,563 (GRCm39) missense probably damaging 1.00
R9778:Or10a49 UTSW 7 108,467,698 (GRCm39) missense probably damaging 0.98
Z1186:Or10a49 UTSW 7 108,468,143 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGCAAGCTCCAGTACTGC -3'
(R):5'- GCCTGCATATCCCCATGTAC -3'

Sequencing Primer
(F):5'- CAGTACTGCTGGGGTTTCAC -3'
(R):5'- ATATCCCCATGTACCTGTTCTTGCAG -3'
Posted On 2020-07-13