Mutagenetix > Incidental Mutation

Incidental Mutation 'R8160:Atp7b'

633475

Institutional Source

Beutler Lab

Gene Symbol

Atp7b

Ensembl Gene

ENSMUSG00000006567

Gene Name

ATPase, Cu++ transporting, beta polypeptide

Synonyms

Atp7a, WND, Wilson protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.634) question?

Stock #

R8160 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21992785-22060305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21997559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1273 (A1273V)

Ref Sequence

ENSEMBL: ENSMUSP00000006742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]

AlphaFold

Q64446

Predicted Effect

probably damaging
Transcript: ENSMUST00000006742
AA Change: A1273V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: A1273V

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110738
AA Change: A1158V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: A1158V

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0\|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415F15Rik	T	C	11: 11,487,734	S246P	unknown	Het
Adam12	C	T	7: 133,968,041		probably null	Het
Aldh8a1	A	G	10: 21,395,791	D472G	possibly damaging	Het
Appl1	T	C	14: 26,928,635	I527V	probably benign	Het
Arhgef4	C	A	1: 34,723,574	T637K	unknown	Het
Ccl20	T	A	1: 83,117,822	S35T		Het
Cdh24	C	A	14: 54,638,489	V208F	probably damaging	Het
Dchs2	A	T	3: 83,270,805	Q1055L	probably benign	Het
Dock8	G	A	19: 25,147,347	R1009Q	probably damaging	Het
Ext2	A	T	2: 93,813,762	V58E	probably benign	Het
Fam208a	T	A	14: 27,449,956	N420K	probably damaging	Het
Fam209	A	T	2: 172,472,725	I45F	possibly damaging	Het
Hfm1	T	C	5: 106,896,033	Y579C	probably null	Het
Hipk4	C	T	7: 27,523,761	A82V	possibly damaging	Het
Il17rc	A	G	6: 113,476,528	Y223C	possibly damaging	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Kdm5b	T	A	1: 134,613,919	M744K	probably damaging	Het
Mettl16	T	C	11: 74,817,679	V568A	probably damaging	Het
Mink1	C	T	11: 70,606,081	Q422*	probably null	Het
Mvb12b	G	T	2: 33,840,222	D81E	probably benign	Het
Nostrin	A	T	2: 69,179,466	I313F	probably damaging	Het
Nsun6	A	G	2: 15,009,408		probably null	Het
Nt5dc1	T	A	10: 34,324,396	E209V	possibly damaging	Het
Oasl2	T	C	5: 114,901,286		probably benign	Het
Olfr303	C	T	7: 86,395,265	V78M	possibly damaging	Het
Olfr517	C	T	7: 108,868,788	R122Q	possibly damaging	Het
Olfr857	T	A	9: 19,712,789		probably benign	Het
Ppm1h	A	T	10: 122,802,436	T204S	probably benign	Het
Rad51b	T	A	12: 79,303,341	L70I	probably benign	Het
Smok3c	A	G	5: 138,065,024	T258A	possibly damaging	Het
Snai2	T	C	16: 14,706,804	V58A	possibly damaging	Het
St6galnac1	G	A	11: 116,775,490		probably benign	Het

Other mutations in Atp7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Atp7b	APN	8	22011098	missense	possibly damaging	0.91
IGL00981:Atp7b	APN	8	22027527	splice site	probably null
IGL01600:Atp7b	APN	8	22027525	splice site	probably null
IGL01713:Atp7b	APN	8	22028573	missense	probably damaging	1.00
IGL01778:Atp7b	APN	8	21994828	missense	probably benign	0.42
IGL01926:Atp7b	APN	8	22011781	missense	probably damaging	0.98
IGL02312:Atp7b	APN	8	21994770	missense	probably damaging	0.99
IGL02562:Atp7b	APN	8	22028085	missense	probably benign
IGL02573:Atp7b	APN	8	22022470	missense	probably benign	0.00
IGL02603:Atp7b	APN	8	21994776	missense	possibly damaging	0.88
IGL02622:Atp7b	APN	8	22028438	missense	possibly damaging	0.69
IGL02721:Atp7b	APN	8	22022477	missense	probably benign	0.00
IGL03145:Atp7b	APN	8	22018143	missense	probably damaging	1.00
daffodil	UTSW	8	21998266	missense	probably damaging	1.00
menace	UTSW	8	22022365	missense	probably damaging	0.97
PIT4131001:Atp7b	UTSW	8	21994656	missense	probably damaging	1.00
R0023:Atp7b	UTSW	8	22011073	missense	probably damaging	1.00
R0046:Atp7b	UTSW	8	22059995	missense	probably benign	0.00
R0128:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0130:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0325:Atp7b	UTSW	8	22028451	missense	probably benign	0.22
R0412:Atp7b	UTSW	8	21995659	splice site	probably null
R0856:Atp7b	UTSW	8	21997631	missense	probably damaging	1.00
R0906:Atp7b	UTSW	8	22027826	missense	probably benign
R0989:Atp7b	UTSW	8	22028694	missense	possibly damaging	0.51
R1377:Atp7b	UTSW	8	22011785	missense	probably benign	0.17
R1517:Atp7b	UTSW	8	21997358	missense	probably damaging	1.00
R1521:Atp7b	UTSW	8	22027673	missense	probably damaging	0.96
R1529:Atp7b	UTSW	8	22028724	missense	possibly damaging	0.87
R1691:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R1743:Atp7b	UTSW	8	22006387	missense	probably damaging	1.00
R1815:Atp7b	UTSW	8	22011651	missense	possibly damaging	0.80
R2008:Atp7b	UTSW	8	22027980	missense	probably damaging	1.00
R2133:Atp7b	UTSW	8	22011077	missense	probably damaging	1.00
R2155:Atp7b	UTSW	8	22013584	missense	possibly damaging	0.69
R2182:Atp7b	UTSW	8	22014547	missense	probably damaging	0.99
R2256:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2257:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2274:Atp7b	UTSW	8	22020832	missense	probably benign	0.20
R2475:Atp7b	UTSW	8	21994776	missense	possibly damaging	0.88
R2906:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R2907:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R3421:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3422:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3688:Atp7b	UTSW	8	22004230	missense	probably damaging	1.00
R3945:Atp7b	UTSW	8	22020864	missense	probably benign	0.02
R4235:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R4700:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4701:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4877:Atp7b	UTSW	8	22028601	missense	probably damaging	0.98
R4962:Atp7b	UTSW	8	22020885	missense	probably damaging	1.00
R5009:Atp7b	UTSW	8	22027698	missense	possibly damaging	0.88
R5016:Atp7b	UTSW	8	22015869	splice site	probably null
R5038:Atp7b	UTSW	8	22028456	missense	possibly damaging	0.67
R5438:Atp7b	UTSW	8	22014554	missense	probably benign
R5467:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R5468:Atp7b	UTSW	8	22059970	critical splice donor site	probably null
R5512:Atp7b	UTSW	8	22012739	missense	probably benign	0.20
R5563:Atp7b	UTSW	8	22028714	missense	possibly damaging	0.82
R5751:Atp7b	UTSW	8	22018128	missense	probably damaging	1.00
R5773:Atp7b	UTSW	8	22027863	missense	probably benign
R5941:Atp7b	UTSW	8	21997496	missense	probably damaging	0.98
R6227:Atp7b	UTSW	8	22020825	missense	possibly damaging	0.63
R6265:Atp7b	UTSW	8	22015927	nonsense	probably null
R6290:Atp7b	UTSW	8	22020820	missense	probably damaging	1.00
R6368:Atp7b	UTSW	8	22020755	splice site	probably null
R6647:Atp7b	UTSW	8	22028478	missense	probably damaging	1.00
R6788:Atp7b	UTSW	8	22004375	missense	probably benign	0.37
R6830:Atp7b	UTSW	8	22022365	missense	probably damaging	0.97
R6886:Atp7b	UTSW	8	22028690	missense	probably benign	0.01
R6928:Atp7b	UTSW	8	21994812	missense	probably benign
R6965:Atp7b	UTSW	8	22028085	missense	probably benign
R7203:Atp7b	UTSW	8	21997335	missense	probably damaging	1.00
R7222:Atp7b	UTSW	8	22022378	nonsense	probably null
R7344:Atp7b	UTSW	8	21997499	missense	probably damaging	1.00
R7384:Atp7b	UTSW	8	22022315	missense	probably benign	0.01
R7449:Atp7b	UTSW	8	22011849	missense	probably damaging	0.98
R7451:Atp7b	UTSW	8	22014684	nonsense	probably null
R7607:Atp7b	UTSW	8	22011506	missense	probably damaging	1.00
R8140:Atp7b	UTSW	8	22028560	missense	probably damaging	1.00
R8349:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8421:Atp7b	UTSW	8	22028471	missense	probably benign	0.01
R8449:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8749:Atp7b	UTSW	8	22028318	missense	probably damaging	0.96
R8989:Atp7b	UTSW	8	22020895	missense	probably benign	0.06
R9210:Atp7b	UTSW	8	21997390	missense	probably damaging	1.00
R9353:Atp7b	UTSW	8	22027874	missense	possibly damaging	0.78
R9462:Atp7b	UTSW	8	22000144	missense	probably damaging	0.99
R9485:Atp7b	UTSW	8	22012762	missense	probably damaging	0.99
Z1176:Atp7b	UTSW	8	22028714	missense	probably benign	0.07
Z1177:Atp7b	UTSW	8	21994877	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGATGAATGCTGGCCACG -3'
(R):5'- TGTGGAAACCCAACTGCTACTG -3'

Sequencing Primer
(F):5'- GACGTCCAATAAGTCATTCTACAGG -3'
(R):5'- ACCCAACTGCTACTGTGGATC -3'

Posted On

2020-07-13