Incidental Mutation 'R8160:Ppm1h'
ID633478
Institutional Source Beutler Lab
Gene Symbol Ppm1h
Ensembl Gene ENSMUSG00000034613
Gene Nameprotein phosphatase 1H (PP2C domain containing)
SynonymsARHCL1, A430075L18Rik, C030002B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location122678762-122945795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122802436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 204 (T204S)
Ref Sequence ENSEMBL: ENSMUSP00000066561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067918] [ENSMUST00000161487]
Predicted Effect probably benign
Transcript: ENSMUST00000067918
AA Change: T204S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066561
Gene: ENSMUSG00000034613
AA Change: T204S

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 504 1.22e-35 SMART
PP2C_SIG 136 506 1.59e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161487
AA Change: T204S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124982
Gene: ENSMUSG00000034613
AA Change: T204S

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 455 6.36e-25 SMART
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Ppm1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Ppm1h APN 10 122878629 critical splice donor site probably null
IGL01060:Ppm1h APN 10 122907571 missense possibly damaging 0.49
IGL01557:Ppm1h APN 10 122782181 critical splice acceptor site probably null
IGL01608:Ppm1h APN 10 122941280 nonsense probably null
IGL02112:Ppm1h APN 10 122802400 missense possibly damaging 0.86
R0129:Ppm1h UTSW 10 122941355 missense probably damaging 0.97
R0217:Ppm1h UTSW 10 122920735 missense probably damaging 1.00
R0309:Ppm1h UTSW 10 122920782 missense probably damaging 1.00
R0455:Ppm1h UTSW 10 122802324 missense probably benign 0.00
R1144:Ppm1h UTSW 10 122941278 missense probably benign 0.01
R1430:Ppm1h UTSW 10 122857099 missense probably damaging 1.00
R2014:Ppm1h UTSW 10 122920725 missense possibly damaging 0.79
R2021:Ppm1h UTSW 10 122878528 nonsense probably null
R2882:Ppm1h UTSW 10 122941334 missense probably damaging 0.99
R3767:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3768:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3770:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R4816:Ppm1h UTSW 10 122679379 missense possibly damaging 0.89
R4996:Ppm1h UTSW 10 122941340 missense probably damaging 1.00
R5640:Ppm1h UTSW 10 122782278 missense probably benign 0.30
R6199:Ppm1h UTSW 10 122920739 missense probably damaging 1.00
R7759:Ppm1h UTSW 10 122904113 missense probably benign
R7991:Ppm1h UTSW 10 122782247 missense probably benign 0.00
R8300:Ppm1h UTSW 10 122782213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACACAGATCCTCACTTC -3'
(R):5'- AGCAAGGAAGTTTTGGCGC -3'

Sequencing Primer
(F):5'- CCGAAGGCATCTCCTGC -3'
(R):5'- CGCGAGCTACATCAATGGC -3'
Posted On2020-07-13