Incidental Mutation 'R8160:Mink1'
ID633480
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 70606081 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 422 (Q422*)
Ref Sequence ENSEMBL: ENSMUSP00000099619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect probably null
Transcript: ENSMUST00000072237
AA Change: Q422*
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: Q422*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072873
AA Change: Q422*
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: Q422*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079244
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: Q419*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102558
AA Change: Q422*
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: Q422*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102559
AA Change: Q422*
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: Q422*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136663
AA Change: Q275*
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: Q275*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably null
Transcript: ENSMUST00000178764
AA Change: Q100*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
R7396:Mink1 UTSW 11 70605168 missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70609629 missense probably benign 0.18
R7723:Mink1 UTSW 11 70612910 missense probably benign 0.16
R7896:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70603768 nonsense probably null
R8082:Mink1 UTSW 11 70613277 missense possibly damaging 0.71
R8335:Mink1 UTSW 11 70609575 missense probably damaging 0.97
R8353:Mink1 UTSW 11 70610328 missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70610328 missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70610076 critical splice acceptor site probably null
R9072:Mink1 UTSW 11 70608381 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCAGGGCTGGGGATATATGC -3'
(R):5'- ATGAAGGATAGTGCCCCAGG -3'

Sequencing Primer
(F):5'- GCTGGGGATATATGCCTTTCTCTC -3'
(R):5'- CCCCAGGGCAGAGACAAG -3'
Posted On2020-07-13