Incidental Mutation 'R8160:Appl1'
ID 633484
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms 7330406P05Rik, 2900057D21Rik
MMRRC Submission 067586-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R8160 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 26640943-26692567 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26650592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 527 (I527V)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
AlphaFold Q8K3H0
Predicted Effect probably benign
Transcript: ENSMUST00000036570
AA Change: I527V

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: I527V

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 C T 7: 133,569,770 (GRCm39) probably null Het
Aldh8a1 A G 10: 21,271,690 (GRCm39) D472G possibly damaging Het
Arhgef4 C A 1: 34,762,655 (GRCm39) T637K unknown Het
Atp7b G A 8: 22,487,575 (GRCm39) A1273V probably damaging Het
Ccl20 T A 1: 83,095,543 (GRCm39) S35T Het
Cdh24 C A 14: 54,875,946 (GRCm39) V208F probably damaging Het
Dchs2 A T 3: 83,178,112 (GRCm39) Q1055L probably benign Het
Dock8 G A 19: 25,124,711 (GRCm39) R1009Q probably damaging Het
Ext2 A T 2: 93,644,107 (GRCm39) V58E probably benign Het
Fam209 A T 2: 172,314,645 (GRCm39) I45F possibly damaging Het
Hfm1 T C 5: 107,043,899 (GRCm39) Y579C probably null Het
Hipk4 C T 7: 27,223,186 (GRCm39) A82V possibly damaging Het
Il17rc A G 6: 113,453,489 (GRCm39) Y223C possibly damaging Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Kdm5b T A 1: 134,541,657 (GRCm39) M744K probably damaging Het
Mettl16 T C 11: 74,708,505 (GRCm39) V568A probably damaging Het
Mink1 C T 11: 70,496,907 (GRCm39) Q422* probably null Het
Mvb12b G T 2: 33,730,234 (GRCm39) D81E probably benign Het
Nostrin A T 2: 69,009,810 (GRCm39) I313F probably damaging Het
Nsun6 A G 2: 15,014,219 (GRCm39) probably null Het
Nt5dc1 T A 10: 34,200,392 (GRCm39) E209V possibly damaging Het
Oasl2 T C 5: 115,039,347 (GRCm39) probably benign Het
Or10a49 C T 7: 108,467,995 (GRCm39) R122Q possibly damaging Het
Or6aa1 C T 7: 86,044,473 (GRCm39) V78M possibly damaging Het
Or7e166 T A 9: 19,624,085 (GRCm39) probably benign Het
Ppm1h A T 10: 122,638,341 (GRCm39) T204S probably benign Het
Rad51b T A 12: 79,350,115 (GRCm39) L70I probably benign Het
Smok3c A G 5: 138,063,286 (GRCm39) T258A possibly damaging Het
Snai2 T C 16: 14,524,668 (GRCm39) V58A possibly damaging Het
Spmip7 T C 11: 11,437,734 (GRCm39) S246P unknown Het
St6galnac1 G A 11: 116,666,316 (GRCm39) probably benign Het
Tasor T A 14: 27,171,913 (GRCm39) N420K probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26,671,433 (GRCm39) missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26,681,427 (GRCm39) splice site probably benign
IGL01633:Appl1 APN 14 26,684,795 (GRCm39) missense probably damaging 0.99
IGL01945:Appl1 APN 14 26,650,612 (GRCm39) missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26,647,909 (GRCm39) splice site probably benign
IGL02650:Appl1 APN 14 26,672,665 (GRCm39) missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26,671,418 (GRCm39) missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26,673,473 (GRCm39) missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26,650,600 (GRCm39) missense probably damaging 1.00
R0183:Appl1 UTSW 14 26,684,811 (GRCm39) missense probably damaging 1.00
R0323:Appl1 UTSW 14 26,664,695 (GRCm39) missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26,662,213 (GRCm39) missense probably benign
R1213:Appl1 UTSW 14 26,665,950 (GRCm39) missense probably benign 0.27
R1277:Appl1 UTSW 14 26,649,813 (GRCm39) missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26,645,811 (GRCm39) missense probably damaging 1.00
R1856:Appl1 UTSW 14 26,649,706 (GRCm39) missense probably damaging 1.00
R1889:Appl1 UTSW 14 26,647,470 (GRCm39) splice site probably benign
R2145:Appl1 UTSW 14 26,671,576 (GRCm39) missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3722:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3917:Appl1 UTSW 14 26,650,561 (GRCm39) missense probably damaging 1.00
R4700:Appl1 UTSW 14 26,647,928 (GRCm39) missense probably benign 0.00
R5139:Appl1 UTSW 14 26,669,112 (GRCm39) missense probably benign 0.04
R5485:Appl1 UTSW 14 26,684,823 (GRCm39) missense probably damaging 1.00
R5536:Appl1 UTSW 14 26,645,737 (GRCm39) nonsense probably null
R5795:Appl1 UTSW 14 26,664,773 (GRCm39) missense probably benign 0.01
R7044:Appl1 UTSW 14 26,650,634 (GRCm39) missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26,685,617 (GRCm39) missense probably benign 0.01
R7447:Appl1 UTSW 14 26,681,409 (GRCm39) nonsense probably null
R7943:Appl1 UTSW 14 26,667,525 (GRCm39) missense probably benign 0.01
R8110:Appl1 UTSW 14 26,649,751 (GRCm39) nonsense probably null
R8129:Appl1 UTSW 14 26,671,466 (GRCm39) missense possibly damaging 0.87
R8211:Appl1 UTSW 14 26,667,555 (GRCm39) missense probably benign 0.18
R8239:Appl1 UTSW 14 26,686,914 (GRCm39) missense probably damaging 0.99
R8379:Appl1 UTSW 14 26,647,372 (GRCm39) critical splice donor site probably null
R8464:Appl1 UTSW 14 26,674,985 (GRCm39) nonsense probably null
R8699:Appl1 UTSW 14 26,662,212 (GRCm39) missense probably benign
R9023:Appl1 UTSW 14 26,685,652 (GRCm39) missense possibly damaging 0.93
R9090:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9203:Appl1 UTSW 14 26,682,970 (GRCm39) nonsense probably null
R9227:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9230:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9243:Appl1 UTSW 14 26,649,710 (GRCm39) missense possibly damaging 0.62
R9271:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9378:Appl1 UTSW 14 26,649,784 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGTGAGCCTTGTAACTTG -3'
(R):5'- CTTTTGGGAAACAACTGTAGGATTG -3'

Sequencing Primer
(F):5'- GGGTCTGCGGATCAATTAACC -3'
(R):5'- ATATGCATGTATTGTGAGTTAAGGCC -3'
Posted On 2020-07-13