Mutagenetix > Incidental Mutation

Incidental Mutation 'R8160:Appl1'

633484

Institutional Source

Beutler Lab

Gene Symbol

Appl1

Ensembl Gene

ENSMUSG00000040760

Gene Name

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1

Synonyms

7330406P05Rik, 2900057D21Rik

MMRRC Submission

067586-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R8160 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26918988-26971232 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26928635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 527 (I527V)

Ref Sequence

ENSEMBL: ENSMUSP00000042875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036570]

AlphaFold

Q8K3H0

Predicted Effect

probably benign
Transcript: ENSMUST00000036570
AA Change: I527V

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: I527V

Domain	Start	End	E-Value	Type
Pfam:BAR_3	7	249	2.6e-66	PFAM
PH	278	377	1.4e-3	SMART
low complexity region	425	434	N/A	INTRINSIC
Pfam:PID	501	632	6.6e-12	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	679	700	N/A	INTRINSIC

Meta Mutation Damage Score

0.0652

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam12	C	T	7: 133,968,041		probably null	Het
Aldh8a1	A	G	10: 21,395,791	D472G	possibly damaging	Het
Arhgef4	C	A	1: 34,723,574	T637K	unknown	Het
Atp7b	G	A	8: 21,997,559	A1273V	probably damaging	Het
Ccl20	T	A	1: 83,117,822	S35T		Het
Cdh24	C	A	14: 54,638,489	V208F	probably damaging	Het
Dchs2	A	T	3: 83,270,805	Q1055L	probably benign	Het
Dock8	G	A	19: 25,147,347	R1009Q	probably damaging	Het
Ext2	A	T	2: 93,813,762	V58E	probably benign	Het
Fam208a	T	A	14: 27,449,956	N420K	probably damaging	Het
Fam209	A	T	2: 172,472,725	I45F	possibly damaging	Het
Hfm1	T	C	5: 106,896,033	Y579C	probably null	Het
Hipk4	C	T	7: 27,523,761	A82V	possibly damaging	Het
Il17rc	A	G	6: 113,476,528	Y223C	possibly damaging	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Kdm5b	T	A	1: 134,613,919	M744K	probably damaging	Het
Mettl16	T	C	11: 74,817,679	V568A	probably damaging	Het
Mink1	C	T	11: 70,606,081	Q422*	probably null	Het
Mvb12b	G	T	2: 33,840,222	D81E	probably benign	Het
Nostrin	A	T	2: 69,179,466	I313F	probably damaging	Het
Nsun6	A	G	2: 15,009,408		probably null	Het
Nt5dc1	T	A	10: 34,324,396	E209V	possibly damaging	Het
Oasl2	T	C	5: 114,901,286		probably benign	Het
Olfr303	C	T	7: 86,395,265	V78M	possibly damaging	Het
Olfr517	C	T	7: 108,868,788	R122Q	possibly damaging	Het
Olfr857	T	A	9: 19,712,789		probably benign	Het
Ppm1h	A	T	10: 122,802,436	T204S	probably benign	Het
Rad51b	T	A	12: 79,303,341	L70I	probably benign	Het
Smok3c	A	G	5: 138,065,024	T258A	possibly damaging	Het
Snai2	T	C	16: 14,706,804	V58A	possibly damaging	Het
Spata48	T	C	11: 11,487,734	S246P	unknown	Het
St6galnac1	G	A	11: 116,775,490		probably benign	Het

Other mutations in Appl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Appl1	APN	14	26949476	missense	possibly damaging	0.89
IGL01615:Appl1	APN	14	26959470	splice site	probably benign
IGL01633:Appl1	APN	14	26962838	missense	probably damaging	0.99
IGL01945:Appl1	APN	14	26928655	missense	possibly damaging	0.80
IGL02210:Appl1	APN	14	26925952	splice site	probably benign
IGL02650:Appl1	APN	14	26950708	missense	possibly damaging	0.76
IGL02674:Appl1	APN	14	26949461	missense	possibly damaging	0.86
IGL02803:Appl1	APN	14	26951516	missense	possibly damaging	0.93
R0129:Appl1	UTSW	14	26928643	missense	probably damaging	1.00
R0183:Appl1	UTSW	14	26962854	missense	probably damaging	1.00
R0323:Appl1	UTSW	14	26942738	missense	possibly damaging	0.91
R0411:Appl1	UTSW	14	26940256	missense	probably benign
R1213:Appl1	UTSW	14	26943993	missense	probably benign	0.27
R1277:Appl1	UTSW	14	26927856	missense	possibly damaging	0.87
R1668:Appl1	UTSW	14	26923854	missense	probably damaging	1.00
R1856:Appl1	UTSW	14	26927749	missense	probably damaging	1.00
R1889:Appl1	UTSW	14	26925513	splice site	probably benign
R2145:Appl1	UTSW	14	26949619	missense	possibly damaging	0.66
R3720:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3722:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3917:Appl1	UTSW	14	26928604	missense	probably damaging	1.00
R4700:Appl1	UTSW	14	26925971	missense	probably benign	0.00
R5139:Appl1	UTSW	14	26947155	missense	probably benign	0.04
R5485:Appl1	UTSW	14	26962866	missense	probably damaging	1.00
R5536:Appl1	UTSW	14	26923780	nonsense	probably null
R5795:Appl1	UTSW	14	26942816	missense	probably benign	0.01
R7044:Appl1	UTSW	14	26928677	missense	possibly damaging	0.90
R7318:Appl1	UTSW	14	26963660	missense	probably benign	0.01
R7447:Appl1	UTSW	14	26959452	nonsense	probably null
R7943:Appl1	UTSW	14	26945568	missense	probably benign	0.01
R8110:Appl1	UTSW	14	26927794	nonsense	probably null
R8129:Appl1	UTSW	14	26949509	missense	possibly damaging	0.87
R8211:Appl1	UTSW	14	26945598	missense	probably benign	0.18
R8239:Appl1	UTSW	14	26964957	missense	probably damaging	0.99
R8379:Appl1	UTSW	14	26925415	critical splice donor site	probably null
R8464:Appl1	UTSW	14	26953028	nonsense	probably null
R8699:Appl1	UTSW	14	26940255	missense	probably benign
R9023:Appl1	UTSW	14	26963695	missense	possibly damaging	0.93
R9090:Appl1	UTSW	14	26947127	missense	probably benign	0.01
R9203:Appl1	UTSW	14	26961013	nonsense	probably null
R9227:Appl1	UTSW	14	26923735	missense	unknown
R9230:Appl1	UTSW	14	26923735	missense	unknown
R9243:Appl1	UTSW	14	26927753	missense	possibly damaging	0.62
R9271:Appl1	UTSW	14	26947127	missense	probably benign	0.01
R9378:Appl1	UTSW	14	26927827	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACTGTGAGCCTTGTAACTTG -3'
(R):5'- CTTTTGGGAAACAACTGTAGGATTG -3'

Sequencing Primer
(F):5'- GGGTCTGCGGATCAATTAACC -3'
(R):5'- ATATGCATGTATTGTGAGTTAAGGCC -3'

Posted On

2020-07-13