Incidental Mutation 'R8160:Cdh24'
ID633486
Institutional Source Beutler Lab
Gene Symbol Cdh24
Ensembl Gene ENSMUSG00000059674
Gene Namecadherin-like 24
SynonymsEY-cadherin, cadherin 14-like, 1700040A22Rik, ENSMUSG00000022188
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54631231-54641364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54638489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 208 (V208F)
Ref Sequence ENSEMBL: ENSMUSP00000066005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000022794] [ENSMUST00000067784] [ENSMUST00000111484] [ENSMUST00000126166] [ENSMUST00000141453] [ENSMUST00000148754] [ENSMUST00000150371] [ENSMUST00000167015] [ENSMUST00000169818]
Predicted Effect probably benign
Transcript: ENSMUST00000022793
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067784
AA Change: V208F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066005
Gene: ENSMUSG00000059674
AA Change: V208F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 148 7.85e-18 SMART
CA 172 257 3.23e-28 SMART
CA 281 369 4.24e-14 SMART
CA 396 477 1.48e-22 SMART
Blast:CA 500 581 3e-31 BLAST
transmembrane domain 602 624 N/A INTRINSIC
Pfam:Cadherin_C 627 775 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126166
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138321
SMART Domains Protein: ENSMUSP00000119326
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Pfam:RSB_motif 20 128 4.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141453
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147714
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150371
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167015
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169818
SMART Domains Protein: ENSMUSP00000131860
Gene: ENSMUSG00000091306

DomainStartEndE-ValueType
low complexity region 1 61 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Cdh24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Cdh24 APN 14 54638432 missense probably benign 0.01
IGL02597:Cdh24 APN 14 54633515 missense possibly damaging 0.55
R0088:Cdh24 UTSW 14 54633714 missense probably damaging 1.00
R0480:Cdh24 UTSW 14 54632597 missense probably benign 0.38
R0890:Cdh24 UTSW 14 54632594 missense probably benign 0.00
R1525:Cdh24 UTSW 14 54638589 missense probably damaging 1.00
R1591:Cdh24 UTSW 14 54636342 missense probably benign 0.19
R1727:Cdh24 UTSW 14 54638638 nonsense probably null
R3757:Cdh24 UTSW 14 54632180 missense possibly damaging 0.92
R4786:Cdh24 UTSW 14 54637550 missense possibly damaging 0.65
R4921:Cdh24 UTSW 14 54633215 missense probably damaging 1.00
R4929:Cdh24 UTSW 14 54633516 missense probably benign 0.00
R5116:Cdh24 UTSW 14 54636413 missense probably benign 0.34
R5589:Cdh24 UTSW 14 54637375 missense probably damaging 1.00
R5682:Cdh24 UTSW 14 54637348 missense probably damaging 1.00
R5774:Cdh24 UTSW 14 54639057 missense probably damaging 0.99
R6305:Cdh24 UTSW 14 54632356 missense possibly damaging 0.62
R7090:Cdh24 UTSW 14 54639507 missense probably damaging 1.00
R7186:Cdh24 UTSW 14 54633492 missense probably benign 0.03
R7361:Cdh24 UTSW 14 54638921 missense possibly damaging 0.74
R7488:Cdh24 UTSW 14 54632180 missense possibly damaging 0.92
R7623:Cdh24 UTSW 14 54638090 missense probably damaging 1.00
R7823:Cdh24 UTSW 14 54637418 missense probably damaging 1.00
R7973:Cdh24 UTSW 14 54639020 missense possibly damaging 0.87
R8017:Cdh24 UTSW 14 54638632 missense probably damaging 1.00
R8019:Cdh24 UTSW 14 54638632 missense probably damaging 1.00
R8029:Cdh24 UTSW 14 54639399 missense probably damaging 1.00
R8070:Cdh24 UTSW 14 54632573 missense probably benign
R8692:Cdh24 UTSW 14 54638336 missense probably benign 0.29
R8862:Cdh24 UTSW 14 54632417 missense probably damaging 1.00
R8915:Cdh24 UTSW 14 54639155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTAAAGGATTGTTTGGGCACAG -3'
(R):5'- GGACGTCTGTAATCCAAGTGAC -3'

Sequencing Primer
(F):5'- ATTGTTTGGGCACAGAACTGC -3'
(R):5'- TGTAATCCAAGTGACTGCTCAC -3'
Posted On2020-07-13